ORF.py

# Finding the Longest Open Reading Frame (ORF)

def find_orfs(dna_sequence):
    """
    Finds all open reading frames (ORFs) in the DNA sequence and returns the longest one.
    ORF = starts with 'ATG' and ends with a stop codon ('TAA', 'TAG', 'TGA').
    """
    stop_codons = ["TAA", "TAG", "TGA"]
    longest_orf = ""
    
    for frame in range(3):  # 3 possible reading frames
        i = frame
        while i < len(dna_sequence) - 2:
            codon = dna_sequence[i:i+3]
            if codon == "ATG":  # Start codon
                j = i
                while j < len(dna_sequence) - 2:
                    next_codon = dna_sequence[j:j+3]
                    if next_codon in stop_codons:
                        orf = dna_sequence[i:j+3]
                        if len(orf) > len(longest_orf):
                            longest_orf = orf
                        break
                    j += 3
            i += 3
    return longest_orf

# Example DNA sequence
dna = "ATGAAATGAAAAATAGGGTGACATGCCCTAA"

# Run the function
longest = find_orfs(dna)

print("DNA Sequence:", dna)
print("Longest ORF:", longest)
print("Length of ORF:", len(longest))