diff --git a/CITATION.cff b/CITATION.cff index c04c0aa6..cfd18d90 100644 --- a/CITATION.cff +++ b/CITATION.cff @@ -1,6 +1,6 @@ title: STRchive -version: 2.15.0 -date-released: "2026-1-21" +version: 2.16.0 +date-released: "2026-02-17" url: https://github.com/dashnowlab/STRchive authors: - family-names: Dashnow diff --git a/data/STRchive-citations.json b/data/STRchive-citations.json index 4291c68a..44ea3b9b 100644 --- a/data/STRchive-citations.json +++ b/data/STRchive-citations.json @@ -157344,7 +157344,1187 @@ "note": "PMID: 20301600\nThis CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: url:https://www.ncbi.nlm.nih.gov/books/NBK1427" }, { +<<<<<<< HEAD + "id": "pmid:41552385", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41552385", + "title": "An acyclic nucleic acid-modified siRNA targeting CAG expansions for polyglutamine disease treatment.", + "type": "article-journal", + "doi": "10.1016/j.omtn.2025.102802", + "authors": [ + ["Kentaro", "Maeda"], + ["Tomoki", "Hirunagi"], + ["Kentaro", "Sahashi"], + ["Yukiko", "Kamiya"], + ["Madoka", "Iida"], + ["Kenji", "Sakakibara"], + ["Kazunari", "Onodera"], + ["Manabu", "Ohyama"], + ["Yohei", "Okada"], + ["Hideyuki", "Okano"], + ["Hiroyuki", "Asanuma"], + ["Masahisa", "Katsuno"] + ], + "publisher": "Molecular therapy. Nucleic acids", + "issn": "2162-2531", + "date": "2025-12-11", + "abstract": "Polyglutamine (polyQ) diseases are inherited neurological disorders caused by an expansion of the cytosine-adenine-guanine (CAG) repeat in the causative genes. These include Huntington's disease, spinal and bulbar muscular atrophy (SBMA), and spinocerebellar ataxias (SCAs). Clinical trials have been conducted using nucleic acid therapeutics to silence the causative gene for these diseases, but none have been approved for use. Furthermore, while oligonucleotides targeting the CAG repeats are an attractive therapeutic option, concomitant silencing of the wild-type allele with normal CAG repeats can result in neuronal dysfunction. In this study, we developed an acyclic serinol nucleic acid (SNA)-modified small interfering RNA (siRNA) targeting CAG repeats. We also evaluated the safety and efficacy of the siRNA in different mouse models of polyQ diseases. Intracerebroventricularly administered siRNA was widely distributed throughout the central nervous system, where it selectively silenced the alleles encoding polyQ proteins without affecting their wild-type counterparts. Consequently, the intranuclear aggregation of polyQ proteins was reduced in mouse models of SBMA and SCA type 3. The siRNA attenuated neuromuscular degeneration and improved the lifespan and motor function of the SBMA mice. These findings suggest that SNA-modified siRNAs targeting CAG repeats represent a promising approach for treating polyQ diseases.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41552385" +}, +{ + "id": "pmid:41513898", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41513898", + "title": "Heterogeneous phenotype and cardiovascular comorbidities in Swedish patients with spinobulbar muscular atrophy.", + "type": "article-journal", + "doi": "10.1007/s00415-025-13605-z", + "authors": [ + ["Anna-Karin", "Roos"], + ["Simon", "Forsberg"], + ["Erica", "Stenvall"], + ["Peter M", "Andersen"], + ["Per", "Zetterstr\u00f6m"], + ["Angelica", "Nordin"], + ["Karin M E", "Forsberg"] + ], + "publisher": "Journal of neurology", + "issn": "1432-1459", + "date": "2026-01-10", + "abstract": "Spinobulbar muscular atrophy (SBMA) is an X-linked neuromuscular disorder characterized by adult-onset progressive muscle atrophy, flaccid paresis, and bulbar palsy. In addition, increasing evidence indicates that SBMA is a multisystem disorder with prominent non-motor symptoms, such as sensory neuropathy, androgen insensitivity, and glucose intolerance. This study aimed to further characterize the clinical manifestations and biomarker profile in a large Swedish SBMA cohort.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41513898" +}, +{ + "id": "pmid:41624332", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41624332", + "title": "Atrophin-1 antisense oligonucleotide provides robust protection from pathology in a fully humanized DRPLA model.", + "type": "article-journal", + "doi": "10.1016/j.omtn.2025.102815", + "authors": [ + ["Velvet L", "Smith"], + ["Bereket Z", "Gidi"], + ["Robert M", "Bragg"], + ["Jeffrey P", "Cantle"], + ["Aliza", "Ben-Varon"], + ["Briana", "Noble"], + ["Silvia", "Prades"], + ["Andrea", "Compton"], + ["Julie", "Greenfield"], + ["Joanna A", "Korecka"], + ["Anya", "Gemos"], + ["Timothy", "Yu"], + ["Vikram", "Khurana"], + ["Holly B", "Kordasiewicz"], + ["Hien T", "Zhao"], + ["Melissa", "Barker-Haliski"], + ["Daniel D", "Child"], + ["Jeffrey B", "Carroll"] + ], + "publisher": "Molecular therapy. Nucleic acids", + "issn": "2162-2531", + "date": "2025-12-31", + "abstract": "Dentatorubral-pallidoluysian atrophy (DRPLA) is a fatal neurodegenerative disease arising from a CAG repeat expansion in the atrophin-1 (", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41624332" +}, +{ + "id": "pmid:41613623", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41613623", + "title": "Early transcriptomic perturbations highlight the spinal cord as a key pathogenic region in spinocerebellar ataxia type 3.", + "type": "article-journal", + "doi": "10.3389/fncel.2025.1735225", + "authors": [ + ["Jacen", "Emerson"], + ["Brianna S", "Nelthrope"], + ["Emma A", "Walker"], + ["Grace", "Mao"], + ["Hannah K", "Shorrock"], + ["Hayley S", "McLoughlin"] + ], + "publisher": "Frontiers in cellular neuroscience", + "issn": "1662-5102", + "date": "2026-01-14", + "abstract": "Spinocerebellar ataxia type 3 (SCA3) is a neurodegenerative disease caused by polyglutamine repeat expansion in the", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41613623" +}, +{ + "id": "pmid:41612618", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41612618", + "title": "Non-Huntington's disease chorea: an expanding universe with acquired causes.", + "type": "article-journal", + "doi": "10.1093/brain/awag038", + "authors": [ + ["Francisco", "Cardoso"], + ["D\u00e9bora", "Maia"], + ["Ricardo", "Maciel"], + ["Jonathan", "Carr"], + ["Taku", "Hatano"], + ["Alexandra", "Durr"], + ["Werner", "Poewe"] + ], + "publisher": "Brain : a journal of neurology", + "issn": "1460-2156", + "date": "2026-01-30", + "abstract": "Huntington disease (HD) phenocopies are conditions characterized by a phenotype similar to HD but without a pathogenic repeat expansion in the HTT gene. The percentage of patients who have an HD phenotype but subsequently are shown not to carry a repeat expansion ranges from 2% to 40%, depending on the ethnicity and the geographic location of the population studied, as well as the resources available for investigation of the underlying causes. In descending order of frequency, genetic causes are Huntington Disease-like 2/JHP3, spinocerebellar ataxia genes (SCA17/TBP, SCA12/PPP2R2B and SCA3/ATXN3, CACNA1A), and frontotemporal dementia genes (C9orf72, and VCP). In addition, it has been established that a growing list of acquired causes may also mimic HD, including autoimmune illnesses such as primary antiphospholipid syndrome, paraneoplastic chorea, and anti-IGLON5. Here we aim to review the epidemiology, aetiology, clinical and laboratory findings of the wide range of conditions associated with HD phenocopies, and proceed to suggest a practical diagnostic approach to the investigation of HD phenocopies taking into account the age at onset, ethnicity, and geographic location of individuals.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41612618" +}, +{ + "id": "pmid:41623487", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41623487", + "title": "Aberrant CDK4/6-driven cell-cycle reentry drives neuronal loss and defines a therapeutic target in C9orf72 ALS/FTD.", + "type": "article-journal", + "doi": "10.1016/j.isci.2025.114596", + "authors": [ + ["Ling", "Lian"], + ["Hayley", "Robinson"], + ["Noah", "Daniels"], + ["G Aleph", "Prieto"], + ["Gunnar H D", "Poplawski"], + ["Rodrigo", "Lopez-Gonzalez"] + ], + "publisher": "iScience", + "issn": "2589-0042", + "date": "2026-01-02", + "abstract": "The C9orf72 hexanucleotide repeat expansion (G4C2) is the most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), yet targeted therapies remain unavailable. Here, we show that induced pluripotent stem cell (iPSC)-derived post-mitotic neurons from C9orf72 carriers exhibit age-dependent cell-cycle reentry, increased S-phase entry, and elevated cyclin and CDK expression. Mechanistically, arginine-containing dipeptide repeat proteins (poly-GR and poly-PR) translated from G4C2 repeats drive this aberrant activation through stimulation of the CDK4/6 pathway, whereas poly-GP and C9orf72 loss-of-function show no effect. Importantly, the FDA-approved CDK4/6 inhibitor palbociclib normalizes cell-cycle progression, reduces S-phase entry, decreases motor neuron death, and restores synaptic proteins PSD95 and synapsin-1. Single-nucleus RNA sequencing from C9orf72 patient cortex reveals cell-cycle activation within excitatory neuron subclusters and alterations in DNA repair and cell-cycle regulation pathways, supporting our", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41623487" +}, +{ + "id": "pmid:41500252", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41500252", + "title": "Frontotemporal dementia: Clinical aspects, genetics, and neuropathology of a family with a C9ORF72 expansion in Argentina.", + "type": "article-journal", + "doi": "10.1111/bpa.70057", + "authors": [ + ["Karen Daniela", "Rom\u00e1n"], + ["Carolina Agata", "Ardohain"], + ["Ezequiel I", "Surace"], + ["M\u00f3nica Beatriz", "Mezmezian"], + ["Alejandro", "Levy"], + ["Alice", "Baez Lovera"], + ["Carlos", "Turizo"], + ["Marcos G", "Sorbara"], + ["Mar\u00eda M", "Esnaola Y Rojas"], + ["Gast\u00f3n H", "Graviotto"], + ["Gustavo", "Sevlever"], + ["Ricardo F", "Allegri"], + ["Cecilia M", "Serrano"], + ["Nahuel", "Magrath Guimet"] + ], + "publisher": "Brain pathology (Zurich, Switzerland)", + "issn": "1750-3639", + "date": "2026-01-07", + "abstract": "Frontotemporal dementia (FTD) is the second most common cause of early-onset dementia, typically manifesting before the age of 65, with a mean onset at 58\u2009years. FTD may encompass a spectrum of neurodegenerative disorders resulting from frontotemporal lobar degeneration (FTLD), affecting behavior, language, and motor function. Among its clinical variants, the behavioral variant (bvFTD) is the most frequently inherited, often associated with mutations in MAPT, GRN, and C9ORF72, the latter being the most prevalent genetic cause of FTD and FTD-motor neuron disease (FTD-MND). While bvFTD is classically defined by profound behavioral changes and executive dysfunction, cases linked to C9ORF72 expansions exhibit atypical neuropsychiatric features. This study documents two cases within the same family presenting with bvFTD and atypical parkinsonism, associated with a C9ORF72 expansion. Neurocognitive assessments, genetic testing, and neuroimaging (MRI, SPECT) were performed to characterize the clinical phenotype. A detailed review of the familial aggregation of neurodegenerative and psychiatric disorders provided further insight into the genetic contributions to symptomatology. The findings highlight the phenotypic heterogeneity associated with C9ORF72 expansions, demonstrating a spectrum ranging from bvFTD to atypical parkinsonism, with variable neuropsychiatric involvement. While movement disorders in FTD have historically been underestimated, these cases reinforce the association between parkinsonism and familial bvFTD. Given the limited epidemiological data on genetic FTD in Latin America, this study underscores the importance of genetic testing in cases with prominent behavioral and psychiatric symptoms, supporting early identification and genetic counseling for affected families.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41500252" +}, +{ + "id": "pmid:41610137", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41610137", + "title": "Aberrant skeletal muscle morphogenesis and myofiber differentiation characterize equine myotonic dystrophy.", + "type": "article-journal", + "doi": "10.1371/journal.pone.0341655", + "authors": [ + ["Stephanie J", "Valberg"], + ["Zo\u00eb J", "Williams"], + ["Elizabeth G", "Ames"], + ["James R", "Mickelson"], + ["Yvette S", "Nout-Lomas"], + ["Gabriele", "Landolt"], + ["Macarena", "Sanz"], + ["Keri", "Gardner"] + ], + "publisher": "PloS one", + "issn": "1932-6203", + "date": "2026-01-29", + "abstract": "Equine myotonic dystrophy (eMD) is a rare neuromuscular disorder of undetermined origin marked by muscle hypertrophy and stiffness, dystrophic muscle histopathology, and myotonic discharges. In humans, myotonic dystrophy (DM) arises from trinucleotide repeat expansions in dystrophia myotonica protein kinase (DMPK) (DM1) or tetranucleotide expansions in cellular nucleic acid-binding protein (CNBP) (DM2), which disrupt mRNA processing and induce embryonic splicing patterns across multiple genes. In 6 eMD Quarter Horse types, (2-36 months-of-age) and 8 control Quarter Horses we determined: (1) fiber type composition of triceps, gluteal, and semimembranosus muscles; (2) differential gene (DEG) and protein (DEP) expression using transcriptomic and proteomic analyses; (3) presence of repeat expansions in transcripts of DMPK or CNBP and (4) exon 7 retention in CLCN1 or exon 22 splicing in ATP2A1. Predominance and clustering of type 1 fibers, expression of embryonic myosin, and upregulated mitochondrial and sarcomeric DEPs characterized eMD hindlimb musculature. Gene ontology (GO) analysis of 730 upregulated DEGs identified numerous GO terms related to morphogenesis of mesoderm-derived tissues and upregulated genes impacting myoD expression in eMD muscle. Top upregulated DEG involved myogenesis (MYOZ2, SBK2, SBK3, PAMR1), neurons, transcription/translation, cytoskeleton, basement/plasma membranes, and calcium binding/transport. Top upregulated proteins also impacted muscle morphogenesis (MUSTN1, CSRP3, TMSBX4, PDLIM, CALD1) as well as categories of mitochondria, sarcomere, extracellular matrix/ basement membrane, transcription, translation, cell cycle regulation, neurons amongst others. Downregulated DEP primarily impacted mitochondria, the sarcomere and glycogen metabolism. Notably, unlike human myotonic dystrophy, trinucleotide repeat expansions were not found in the DMPK 3'UTR (CTG)n nor tetranucleotide repeat expansions (CCTG)n in intron 1 of CNBP. Isoforms of CLCN1 containing fetal exon 7 were detected in equal frequency in eMD and control muscle and exon 22 was not alternatively spliced in ATP2A1 as has been found in DM1. Thus, distinct from DM1 and DM2, eMD is driven by unique molecular mechanisms impacting skeletal muscle morphogenesis, neurons and regulation of gene transcription/translation that alter fiber type composition, distribution and morphology. The origin of myotonia does not appear to be driven by a mutation in CLCN1 or retention of exon CLCN 7. Expanded splice site analysis and further research is warranted to elucidate the cause of myotonia and the distinct etiology of eMD.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41610137" +}, +{ + "id": "pmid:41533635", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41533635", + "title": "Translational behavioral phenotypes in DMSXL mice for CNS manifestations of DM1.", + "type": "article-journal", + "doi": "10.1177/22143602251410998", + "authors": [ + ["Elisabetta", "Golini"], + ["Aline", "Huguet-Lachon"], + ["H\u00e9l\u00e8ne", "Benyamine"], + ["No\u00ebmy", "Forast\u00e9 Gueriba"], + ["Ferdinando", "Scavizzi"], + ["Marcello", "Raspa"], + ["Germana", "Falcone"], + ["Beatrice", "Cardinali"], + ["Silvia", "Mandillo"], + ["Genevi\u00e8ve", "Gourdon"] + ], + "publisher": "Journal of neuromuscular diseases", + "issn": "2214-3602", + "date": "2026-01-14", + "abstract": "Myotonic dystrophy type 1 (DM1) is a multisystemic disorder frequently associated with central nervous system (CNS) involvement, especially in congenital and childhood-onset forms. However, behavioral alterations in preclinical models have so far been only partially characterized, underscoring the need for more comprehensive analyses to support the development of targeted therapeutic approaches.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41533635" +}, +{ + "id": "pmid:41504274", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41504274", + "title": "Clinical, Genetic, and Imaging Characteristics of SCA27B: Insights from a Large Dutch Cohort.", + "type": "article-journal", + "doi": "10.1002/mds.70190", + "authors": [ + ["Teije H", "van Prooije"], + ["Maartje", "Pennings"], + ["Roderick P P W M", "Maas"], + ["Jeroen", "de Vries"], + ["Corien", "Verschuuren-Bemelmans"], + ["Vincent", "Odekerken"], + ["Sirwan K L", "Darweesh"], + ["Mark", "Huisman"], + ["Mayke", "Oosterloo"], + ["Arthur", "Buijink"], + ["Jaron", "van de Wardt"], + ["Els", "Vanhoutte"], + ["Tsz Hang", "Wong"], + ["Lisette", "Koens"], + ["Eva", "de Boer"], + ["Judith", "van Gaalen"], + ["Martijn", "Beudel"], + ["Dareia S", "Roos"], + ["Jorrit I", "Hoff"], + ["Thimo", "Cornelissen"], + ["Meyke", "Schouten"], + ["Thatjana", "Gardeichik"], + ["Erica", "van der Looij"], + ["Christine", "Klein"], + ["Joanne", "Trinh"], + ["Erik-Jan", "Kamsteeg"], + ["Bart", "van de Warrenburg"] + ], + "publisher": "Movement disorders : official journal of the Movement Disorder Society", + "issn": "1531-8257", + "date": "2026-01-08", + "abstract": "Deep intronic GAA repeat expansions in intron 1 of the FGF14 gene were identified in 2023 as cause of late-onset cerebellar ataxia. Since then, GAA-FGF14-related ataxia (SCA27B) has emerged as one of the most common genetic causes of late-onset cerebellar ataxia.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41504274" +}, +{ + "id": "pmid:41557506", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41557506", + "title": "Metabolic reprogramming during human neuron differentiation indicates glutaminase as a key determinant in Fragile X syndrome.", + "type": "article-journal", + "doi": "10.1016/j.celrep.2025.116857", + "authors": [ + ["Sneha", "Shah"], + ["Daniel", "Barnes"], + ["Botao", "Liu"], + ["Tenzin", "Tseyang"], + ["Thang", "Do"], + ["Jodi L", "Bubenik"], + ["Suna", "Jung"], + ["Mina N", "Anadolu"], + ["Maria P", "Ivshina"], + ["Ver\u00f3nica", "Mart\u00ednez-Cerde\u00f1o"], + ["Elizabeth", "Berry-Kravis"], + ["Maurice S", "Swanson"], + ["Jessica B", "Spinelli"], + ["Joel D", "Richter"] + ], + "publisher": "Cell reports", + "issn": "2211-1247", + "date": "2026-01-19", + "abstract": "Metabolic homeostasis gone awry is a contributor to, if not an underlying cause of, several neurologic disorders. Fragile X syndrome (FXS) is a neurodevelopmental disorder caused by a trinucleotide repeat expansion in FMR1 and consequent loss of the encoded protein FMRP, which results in downstream molecular, neurologic, and mitochondrial deficits that are linked to cognitive impairment. In the human postmortem brain, many metabolites and solute carrier proteins are coordinately dysregulated, which also occurs during the differentiation of human induced pluripotent stem cells (iPSCs) into excitatory neurons. Metabolic tracing in FXS neurons demonstrates a dearth of glutamine deamidation to glutamate, which reduces anaplerosis into the TCA cycle, potentially hindering the bioenergetic and biosynthetic functions of mitochondria. Mechanistically, aberrant expression of glutaminase isoforms in FXS is responsible for reduced glutaminolysis, thereby altering glutamate levels, which may contribute to FXS.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41557506" +}, +{ + "id": "pmid:41555826", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41555826", + "title": "Cognitive dysfunction in women with the", + "type": "article-journal", + "doi": "10.1177/13872877251414950", + "authors": [ + ["Jessica", "Klusek"], + ["Jillian", "Gierman"], + ["Amanda J", "Fairchild"], + ["Andreana M", "Benitez"], + ["Elizabeth", "Berry-Kravis"], + ["Marsha R", "Mailick"] + ], + "publisher": "Journal of Alzheimer's disease : JAD", + "issn": "1875-8908", + "date": "2026-01-20", + "abstract": "BackgroundThe", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41555826" +}, +{ + "id": "pmid:41523206", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41523206", + "title": "Screening of CGG Trinucleotide Repeats Within", + "type": "article-journal", + "doi": "10.5765/jkacap.250023", + "authors": [ + ["Abdullah Al", "Noman"], + ["Abdullah Al", "Saba"], + ["Maisha", "Adiba"], + ["Molie", "Rahman"], + ["Mohammad", "Sayem"], + ["A H M Nurun", "Nabi"], + ["Tahirah", "Yasmin"] + ], + "publisher": "Journal of the Korean Academy of Child and Adolescent Psychiatry", + "issn": "2233-9183", + "date": "2025-10-20", + "abstract": "Autism spectrum disorder (ASD) is a major neurodevelopmental disorder characterized by persistent deficits in social communication along with restricted, repetitive patterns of behaviour and interests.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41523206" +}, +{ + "id": "pmid:41514368", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41514368", + "title": "Long-read genome sequencing enhances diagnostics of pediatric neurological disorders.", + "type": "article-journal", + "doi": "10.1186/s13073-025-01596-5", + "authors": [ + ["Marlene", "Ek"], + ["Malin", "Kvarnung"], + ["Esmee", "Ten Berk de Boer"], + ["Linn\u00e9a", "La Fleur"], + ["Lena", "Lj\u00f6stad"], + ["Anna", "Lyander"], + ["S\u00f8ren Lejsted", "Faergeman"], + ["Simon Opstrup", "Drue"], + ["H\u00e5kan", "Thonberg"], + ["Ann", "Nordgren"], + ["Maria Johansson", "Soller"], + ["Valtteri", "Wirta"], + ["Jesper", "Eisfeldt"], + ["Anna", "Lindstrand"] + ], + "publisher": "Genome medicine", + "issn": "1756-994X", + "date": "2026-01-09", + "abstract": "Singleton short-read genome sequencing (GS) is increasingly used as a first-line genetic test for childhood neurological disorders (such as intellectual disability, neurodevelopmental delay, motor delay, and hypotonia) with diagnostic yields from 26 to 35%, typically involving a mix of single nucleotide variants and small insertions/deletions (SNV/INDELs), structural variants (SVs), and short tandem repeats (STRs). Long-read GS is emerging as an attractive alternative, offering a more comprehensive assessment of the genome, but its utility still needs to be systematically evaluated in a clinical diagnostic setting.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41514368" +}, +{ + "id": "pmid:41507195", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41507195", + "title": "Integrative transcriptome-wide association analyses reveal PRKCG-linked GABAergic dysfunction in Fragile X-associated tremor/ataxia syndrome.", + "type": "article-journal", + "doi": "10.1038/s41467-025-68163-9", + "authors": [ + ["Yulin", "Jin"], + ["Yiqu", "Cao"], + ["Wenjing", "Ma"], + ["Ronghua", "Li"], + ["Yujing", "Li"], + ["Yunhee", "Kang"], + ["Jing", "Huang"], + ["Michael P", "Epstein"], + ["Xiangxue", "Guo"], + ["Junghwa", "Lim"], + ["Natalia", "Rivera"], + ["Ying", "Zhou"], + ["Zhexing", "Wen"], + ["Emily G", "Allen"], + ["Peng", "Jin"] + ], + "publisher": "Nature communications", + "issn": "2041-1723", + "date": "2026-01-08", + "abstract": "Fragile X-associated tremor/ataxia syndrome (FXTAS) is a neurodegenerative disorder caused by CGG repeat expansions in the FMR1 gene. While CGG repeat toxicity is established, the precise molecular mechanisms driving neurodegeneration remain unclear. Here, we show that a multi-omics strategy combined with TWAS reveals brain-region-specific molecular signatures and striking gene dysregulation in inhibitory neurons. Using conditional mouse models, we demonstrate that selective expression of expanded CGG repeats in GABAergic neurons is sufficient to recapitulate key pathologic hallmarks of FXTAS. We identify PRKCG as a genetic modifier of FXTAS, with cross-species evidence linking its overexpression to disease onset. Many dysregulated mRNAs in GABAergic neurons are targets of hnRNPA2/B1, an RNA-binding protein sequestered by CGG repeat RNA. Functional screening in Drosophila further establishes PRKCG as a potent modulator of CGG-associated neurotoxicity. These findings uncover a critical role of GABAergic neurons in FXTAS pathogenesis and position PRKCG as a promising therapeutic target.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41507195" +}, +{ + "id": "pmid:41501457", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41501457", + "title": "Insights into DNA repeat expansions among 900,000 biobank participants.", + "type": "article-journal", + "doi": "10.1038/s41586-025-09886-z", + "authors": [ + ["Margaux L A", "Hujoel"], + ["Robert E", "Handsaker"], + ["David", "Tang"], + ["Nolan", "Kamitaki"], + ["Ronen E", "Mukamel"], + ["Simone", "Rubinacci"], + ["Pier Francesco", "Palamara"], + ["Steven A", "McCarroll"], + ["Po-Ru", "Loh"] + ], + "publisher": "Nature", + "issn": "1476-4687", + "date": "2026-01-07", + "abstract": "Expansions and contractions of tandem DNA repeats generate genetic variation in human populations and in human tissues.\u00a0Some expanded repeats cause inherited disorders and some are also somatically unstable", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41501457" +}, +{ + "id": "pmid:41622913", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41622913", + "title": "The HTT1a protein initiates HTT aggregation in a knock-in mouse model of Huntington's disease.", + "type": "article-journal", + "doi": "10.1093/brain/awag040", + "authors": [ + ["Aikaterini Smaragdi", "Papadopoulou"], + ["Christian", "Landles"], + ["Edward J", "Smith"], + ["Marie K", "Bondulich"], + ["Annett", "Boeddrich"], + ["Maria", "Canibano-Pico"], + ["Emily C E", "Danby"], + ["Franziska", "Hoschek"], + ["Arzo", "Iqbal"], + ["Samuel T", "Jones"], + ["Nancy", "Neuendorf"], + ["Iulia M", "Nita"], + ["Georgina F", "Osborne"], + ["Jemima", "Phillips"], + ["Maximilian", "Wagner"], + ["Erich E", "Wanker"], + ["Jonathan R", "Greene"], + ["Andreas", "Neueder"], + ["Gillian P", "Bates"] + ], + "publisher": "Brain : a journal of neurology", + "issn": "1460-2156", + "date": "2026-02-02", + "abstract": "The mutation that causes Huntington's disease is a CAG repeat expansion in exon 1 of the huntingtin gene (HTT) that leads to an abnormally long polyglutamine tract in the huntingtin protein (HTT). Mutant CAG repeats are unstable and increase in size in specific neurons and brain regions with age, a phenomenon that constitutes the first step in the pathogenesis of the disease. In the presence of an expanded CAG repeat, cryptic polyA sites in intron 1 of the HTT pre-mRNA can become activated leading to the polyadenylation of a prematurely terminated transcript, HTT1a. This encodes the HTT1a protein, which is known to be very aggregation-prone and highly pathogenic. Given that the longer the CAG repeat the more HTT1a is generated, could the production of HTT1a be the mechanism through which somatic CAG repeat expansion exerts its pathogenic consequences? Resolving this issue is very important for the design of therapeutic approaches to lower huntingtin levels. We have used a CRISPR-Cas9 approach to prevent the production of HTT1a in a knock-in mouse model of Huntington's disease. All potential cryptic polyA sites were deleted from Htt intron 1 in HdhQ150 mice and colonies were established that were heterozygous for the intron 1 deletion on a mutant allele (HdhQ150\u0394I) and heterozygous for the deletion on a wild-type allele (WT\u0394I). The CAG repeat sizes in the HdhQ150 and HdhQ150\u0394I colonies were well-matched at approximately 195 CAGs. As predicted, the deletion of the cryptic polyA sites from Htt intron 1 prevented the generation of the Htt1a transcript in the HdhQ150\u0394I mice. However, very low levels of the HTT1a protein were detected, which resulted from a Htt readthrough product of exon 1 and exon 2, that had retained the deleted intron and terminated at a cryptic polyA site in intron 2. HdhQ150, HdhQ150\u0394I, wild-type and WT\u0394I mice were studied until 17 months of age. Immunohistochemical and homogeneous time resolved fluorescence analysis showed that HTT aggregation in both HdhQ150 and HdhQ150\u0394I brains contained HTT1a, but the dramatic decrease in soluble HTT1a levels in HdhQ150\u0394I brains delayed the appearance of aggregated HTT1a by several months. Although this delay in aggregate pathology only partially reversed transcriptional dysregulation, the biomarkers NEFL and BRP39 (YKL40) remained at wild-type levels in HdhQ150\u0394I mice at 17 months of age. These data demonstrate that the production of HTT1a initiates HTT aggregation and that it is important to target HTT1a in huntingtin-lowering therapeutic strategies.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41622913" +}, +{ + "id": "pmid:41620818", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41620818", + "title": "Functional and Structural Evidence of Neurofluid Circuit Aberrations in Huntington Disease.", + "type": "article-journal", + "doi": "10.1002/acn3.70328", + "authors": [ + ["Kilian", "Hett"], + ["Abigail", "Dubois"], + ["Melanie", "Leguizamon"], + ["Alexander", "Song"], + ["Paula", "Trujillo"], + ["Colin D", "McKnight"], + ["Ciaran M", "Considine"], + ["Manus J", "Donahue"], + ["Daniel O", "Claassen"] + ], + "publisher": "Annals of clinical and translational neurology", + "issn": "2328-9503", + "date": "2026-01-31", + "abstract": "Disrupted neurofluid regulation may contribute to neurodegeneration in Huntington disease (HD). Because neurofluid pathways influence waste clearance, inflammation, and the distribution of central nervous system (CNS)-delivered therapeutics, understanding their dysfunction is increasingly important as targeted treatments emerge. We aimed to evaluate structural and physiological changes in two key neurofluid components, the choroid plexus (ChP), which produces cerebrospinal fluid (CSF), and the parasagittal dural (PSD) space, a major CSF outflow pathway, across the HD spectrum and in relation to CSF flow dynamics.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41620818" +}, +{ + "id": "pmid:41557250", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41557250", + "title": "Dysregulation of store-operated calcium entry in fibroblast lines from adult and juvenile-onset Huntington's disease patients.", + "type": "article-journal", + "doi": "10.1007/s43440-025-00820-8", + "authors": [ + ["Samuel Oluwafemi", "Egbuwalo"], + ["Ewelina", "Latoszek"], + ["Hana", "Hans\u00edkov\u00e1"], + ["Ji\u0159\u00ed", "Klemp\u00ed\u0159"], + ["Al\u017ebeta", "M\u00fchlb\u00e4ck"], + ["Georg Bernhard", "Landwehrmeyer"], + ["Jacek", "Ku\u017anicki"], + ["Magdalena", "Czeredys"] + ], + "publisher": "Pharmacological reports : PR", + "issn": "2299-5684", + "date": "2026-01-20", + "abstract": "The pathology of Huntington's disease (HD) is marked by the aggregation of mutant huntingtin protein (mHTT), which results from expanded polyglutamine (polyQ) residues encoded by CAG repeats in the HTT gene. These repeats are differentially elongated in adult- and juvenile-onset HD. In striatal neurons, the mHTT disrupts cellular mechanisms such as store-operated calcium entry (SOCE), a process in which endoplasmic reticulum Ca\u00b2\u207a depletion triggers extracellular Ca\u00b2\u207a influx; however, this process can also be affected in peripheral cells. The aim of this study was to evaluate SOCE in fibroblasts derived from both HD onset patients and age-related controls.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41557250" +}, +{ + "id": "pmid:41545439", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41545439", + "title": "Lifetime risk of cancer in carriers of intermediate alleles in the HTT gene.", + "type": "article-journal", + "doi": "10.1038/s41598-026-35941-4", + "authors": [ + ["Jimmy", "Sundblom"], + ["Ingvar", "Bergdahl"], + ["Eva-Lena", "Stattin"], + ["Valter", "Niemel\u00e4"] + ], + "publisher": "Scientific reports", + "issn": "2045-2322", + "date": "2026-01-16", + "abstract": "Previous studies have found a markedly reduced risk of cancer among Huntington\u2019s disease (HD) patients with CAG\u2009\u2265\u200940, but data on cancer risk at shorter repeat numbers are lacking. The study includes 8149 subjects from Northern Sweden Health and Disease Study. Genotyping yielded a large number of intermediate allele carriers (IA, CAG", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41545439" +}, +{ + "id": "pmid:41345522", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41345522", + "title": "Analysis of clinically relevant large tandem repeats using nanopore sequencing.", + "type": "article-journal", + "doi": "10.1038/s41598-025-30441-3", + "authors": [ + ["Silvia", "Madritsch"], + ["David", "Horner"], + ["Tamara", "L\u00f6wenstern"], + ["Nadja", "Brait"], + ["Vivienne", "Arnold"], + ["Andrea", "Wenzel"], + ["Denisa", "Weis"], + ["Markus", "Hengstschl\u00e4ger"], + ["Franco", "Laccone"] + ], + "publisher": "Scientific reports", + "issn": "2045-2322", + "date": "2025-12-04", + "abstract": "Variable number tandem repeats (VNTRs) remain among the most challenging regions of the human genome to characterize, due to their repetitive structure and high sequence variability. Short-read sequencing lacks the resolution to span these regions, and even long-read variant callers often fail to resolve true allelic variation due to alignment ambiguity and motif heterogeneity. We present a novel bioinformatics workflow for the analysis of VNTRs from nanopore sequencing data. To our knowledge, it is the first to offer fully automated variant detection, classification of loss-of-function (LoF) variants, and integrated quality control using nanopore sequencing technology. The pipeline separates reads into alleles, constructs reference-free consensus sequences, and aligns motif structures for visualization. LoF variants are identified and reported at their exact position within the repeat. The method was validated using PCR amplicons from reference genomes HG001\u2013HG004 for two genes harboring VNTRs (", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41345522" +}, +{ + "id": "pmid:41556371", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41556371", + "title": "Proteomic Landscape of Sweat Glands in Neuronal Intranuclear Inclusion Disease Reveals a Pathogenic Triad of Abnormal Autophagy, Mitochondrial Dysfunction, and a Failed Oxidative Stress Response.", + "type": "article-journal", + "doi": "10.1111/jnc.70352", + "authors": [ + ["An", "Wang"], + ["Hong-Fei", "Tai"], + ["Kang", "Zhang"], + ["Yi", "Zhou"], + ["Wei", "Sun"], + ["Zheng-Guang", "Guo"], + ["Hai-Dan", "Sun"], + ["Fan", "Jian"], + ["Xin-Gao", "Wang"], + ["Hua", "Pan"], + ["Zai-Qiang", "Zhang"] + ], + "publisher": "Journal of neurochemistry", + "issn": "1471-4159", + "date": "2026-01-01", + "abstract": "Neuronal Intranuclear Inclusion Disease (NIID), caused by GGC repeat expansions in the NOTCH2NLC gene, has a poorly understood molecular pathogenesis. This study aimed to systematically delineate the molecular pathology of NIID for the first time by employing an unbiased proteomic approach in sweat gland tissue. We isolated sweat gland tissue from 20 NIID patients and 6 healthy controls via Laser Capture Microdissection and performed in-depth proteomic analysis using data-independent acquisition mass spectrometry, followed by functional annotation and mechanistic prediction through bioinformatics analyses, including Gene Ontology, Kyoto Encyclopedia of Genes and Genomes, and Ingenuity Pathway Analysis. A total of 265 differentially expressed proteins were identified. Functional enrichment analysis revealed a pathological network composed of three core dysfunctions: (1) widespread mitochondrial dysfunction, evidenced by the general downregulation of proteins associated with energy metabolism and mitochondrial structure; (2) multidimensional autophagy failure, characterized by autophagic flux blockage (macroautophagy failure) and the predicted inhibition of Chaperone-Mediated Autophagy; and (3) a paradoxical and ineffective oxidative stress response, demonstrating a functional uncoupling between the upstream NRF2 activation signal and the execution of the downstream antioxidant pathway. The cellular validation confirmed that the pathogenic uN2CpolyG protein causes the downregulation of core hub proteins, substantiating the molecular pathology observed in patient tissue. Furthermore, a signal decoupling state was identified in the pivotal PI3K-Akt survival pathway. This study provides the first systematic proteomic view of NIID pathology in sweat gland tissue, substantiating that its core pathology is a self-reinforcing vicious cycle of mitochondrial dysfunction, abnormal autophagy, and oxidative stress imbalance. These findings offer a robust molecular framework for understanding GGC repeat expansion pathogenesis and illuminate new therapeutic avenues targeting these interconnected pathways.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41556371" +}, +{ + "id": "pmid:41539185", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41539185", + "title": "Plasma p-tau species are elevated in presymptomatic and symptomatic neuronal intranuclear inclusion disease.", + "type": "article-journal", + "doi": "10.1016/j.ebiom.2026.106127", + "authors": [ + ["Sizhe", "Zhang"], + ["Bin", "Jiao"], + ["Yan", "Zeng"], + ["Qiying", "Sun"], + ["Xiaoyu", "Chen"], + ["Weiwei", "Zhang"], + ["Ziyu", "Ouyang"], + ["Qiao", "Xiao"], + ["Lu", "Zhou"], + ["Yunni", "Li"], + ["Ling", "Weng"], + ["Juan", "Du"], + ["Qian", "Xu"], + ["Yang", "Yang"], + ["Mengqi", "Zhang"], + ["Qiuming", "Zeng"], + ["Liangjuan", "Fang"], + ["Hongyu", "Long"], + ["Yuanyuan", "Xie"], + ["Si", "Chen"], + ["Li", "Feng"], + ["Qing", "Huang"], + ["Lili", "Long"], + ["Yafang", "Zhou"], + ["Fang", "Yi"], + ["Yacen", "Hu"], + ["Qiong", "Liu"], + ["Yongcheng", "Pan"], + ["Lin", "Zhou"], + ["Yulai", "Li"], + ["Shuo", "Hu"], + ["Jifeng", "Guo"], + ["Junling", "Wang"], + ["Hong", "Jiang"], + ["Hongwei", "Xu"], + ["Ranhui", "Duan"], + ["Beisha", "Tang"], + ["Yun", "Tian"], + ["Lu", "Shen"] + ], + "publisher": "EBioMedicine", + "issn": "2352-3964", + "date": "2026-01-14", + "abstract": "Neuronal intranuclear inclusion disease (NIID), caused by GGC repeat expansions in NOTCH2NLC, is a neurodegenerative disease frequently involved with cognitive impairment. Limited studies have focused on the biomarkers alteration in patients with NIID and presymptomatic NIID (preNIID) individuals. The clinical overlap between NIID and AD drives the exploration of plasma biomarker alterations in NIID and preNIID.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41539185" +}, +{ + "id": "pmid:41526374", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41526374", + "title": "Precise excision of expanded GGC repeats in NOTCH2NLC via CRISPR/Cas9 for treating neuronal intranuclear inclusion disease.", + "type": "article-journal", + "doi": "10.1038/s41467-026-68385-5", + "authors": [ + ["Nina", "Xie"], + ["Yongcheng", "Pan"], + ["Huichun", "Tong"], + ["Yingqi", "Lin"], + ["Ying", "Jiang"], + ["Zhiqin", "Wang"], + ["Juan", "Wan"], + ["Wendiao", "Zhang"], + ["Xinhui", "Wang"], + ["Xiaobo", "Sun"], + ["Sen", "Yan"], + ["Peng", "Yin"], + ["Qiying", "Sun"], + ["Chengzhi", "Qi"], + ["Yun", "Tian"], + ["Lu", "Shen"], + ["Hong", "Jiang"], + ["Desheng", "Liang"], + ["Beisha", "Tang"], + ["Shihua", "Li"], + ["Xiao-Jiang", "Li"], + ["Qiong", "Liu"] + ], + "publisher": "Nature communications", + "issn": "2041-1723", + "date": "2026-01-13", + "abstract": "Neuronal intranuclear inclusion disease (NIID) is an adult-onset neurodegenerative disease caused by expanded GGC repeats in the 5' untranslated region of the human-specific NOTCH2NLC gene. The high sequence similarity between NOTCH2NLC and its paralogs poses a significant challenge for precise gene editing. Here, we develop a CRISPR/spCas9-based gene-editing strategy that precisely excises the expanded GGC repeats in NOTCH2NLC without detectable off-target effects on the highly homologous NOTCH2/NOTCH2NL family genes (<2% sequence divergence at this locus). The efficacy, specificity and safety of this approach are rigorously validated across multiple experimental models, including human cell lines, NIID iPSCs, and our previously established transgenic NIID mouse model. Our results demonstrate that precise excision of the expanded GGC repeats effectively alleviates NIID-related neuropathological, molecular and behavioral abnormalities. This study establishes the proof of concept for genome editing as a therapeutic strategy for NIID and other related repeat expansion disorders.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41526374" +}, +{ + "id": "pmid:41587185", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41587185", + "title": "Oculopharyngeal muscular dystrophy (OPMD) associated alanine expansion impairs the function of the nuclear polyadenosine RNA binding protein PABPN1 as revealed by proximity labeling and comparative proteomics.", + "type": "article-journal", + "doi": "10.1371/journal.pgen.1011743", + "authors": [ + ["Allison T", "Mezzell"], + ["Yu", "Zhang"], + ["Alexandra M", "Perez"], + ["Katherine E", "Vest"] + ], + "publisher": "PLoS genetics", + "issn": "1553-7404", + "date": "2026-01-26", + "abstract": "Oculopharyngeal muscular dystrophy (OPMD) is a late-onset disease caused by modest alanine expansion at the amino terminus of the nuclear polyadenosine RNA binding protein PABPN1. PABPN1 is expressed ubiquitously and is involved in multiple steps in RNA processing including optimal cleavage and polyadenylation, polyadenylation signal selection, and export of polyadenylated RNAs from the nucleus. Expanded PABPN1 forms aggregates in a subset of muscle nuclei, but PABPN1 levels are paradoxically low in muscle compared to other tissues. Despite several studies in model systems and patient tissues, it remains unclear whether alanine expansion directly impairs PABPN1 function. The molecular mechanisms leading to OPMD pathology are poorly understood. Here we used a proximity labeling approach to better understand the effect of alanine expansion on PABPN1 function in a cell culture model of skeletal muscle. To avoid the confounding factor of overexpression, PABPN1 constructs containing a carboxy-terminal TurboID tag were expressed in skeletal myotubes at near native levels using an inducible promoter. Although non-expanded PABPN1-TurboID was able to complement RNA export and myoblast differentiation defects caused by deficiency of endogenous PABPN1, alanine expanded PABPN1-TurboID was not. Comparative proteomics revealed increased interaction between expanded PABPN1 and RNA splicing and polyadenylation machinery and follow-up studies identified a dominant negative effect of expanded PABPN1 on RNA export in differentiated myotubes. These data indicate that alanine expansion can impair PABPN1 function regardless of the presence of wild type PABPN1 and support a model wherein both loss function and dominant negative effects of expanded PABPN1 contribute to OPMD pathology.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41587185" +}, +{ + "id": "pmid:41531556", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41531556", + "title": "Paired-Like Homeobox 2B (PHOX2B) Mutation and the Hidden Endocrine Puzzle: Hyperinsulinism in Congenital Central Hypoventilation Syndrome.", + "type": "article-journal", + "doi": "10.7759/cureus.99114", + "authors": [ + ["Mohamad", "Sabsabee"], + ["Manal", "Mustafa"] + ], + "publisher": "Cureus", + "issn": "2168-8184", + "date": "2025-12-13", + "abstract": "Congenital central hypoventilation syndrome (CCHS) is a rare disorder of autonomic control of breathing caused predominantly by paired-like homeobox 2B (PHOX2B) mutations and frequently accompanied by broader autonomic dysfunction affecting cardiovascular, gastrointestinal, and endocrine systems. We report a four-month-old female with genetically confirmed PHOX2B polyalanine repeat expansion (c.726_764dup; p.Ala248_Ala260dup; 33 repeats) who developed recurrent, symptomatic postprandial hypoglycemia after transitioning from continuous enteral feeding to oral bolus feeds. Critical samples during hypoglycemia (blood sugar nadir 26 mg/dL) showed inappropriately elevated insulin and C-peptide with suppressed ketones and appropriate cortisol and growth hormone (GH) responses, while metabolic work-up was otherwise unremarkable. The pattern supported reactive postprandial hyperinsulinemic hypoglycemia due to autonomic dysregulation rather than congenital hyperinsulinism. Glycemic stability was achieved by reinstating slow, continuous feeds and avoiding rapid carbohydrate boluses; dextrose boluses precipitated rebound hypoglycemia. The case underscores an under-recognized endocrine manifestation of PHOX2B-related CCHS and highlights practical management-continuous/slow feeding, cautious use of dextrose, and multidisciplinary follow-up to maintain euglycemia during feeding transitions.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41531556" +}, +{ + "id": "pmid:41614301", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41614301", + "title": "Pentanucleotide guanine-rich WGGGW repeats, including CANVAS AGGGA repeats, form a variety of noncanonical structures.", + "type": "article-journal", + "doi": "10.1093/nar/gkag051", + "authors": [ + ["Jiawei", "Wang"], + ["Dehui", "Qiu"], + ["Jun", "Zhou"], + ["Jean-Louis", "Mergny"], + ["Patrizia", "Alberti"] + ], + "publisher": "Nucleic acids research", + "issn": "1362-4962", + "date": "2026-01-22", + "abstract": "Short tandem repeats (STRs) are an important component of the human genome as they contribute to genetic diversity and can influence gene expression and disease susceptibility. STRs are important in the context of CANVAS (Cerebellar Ataxia, Neuropathy, Vestibular Areflexia Syndrome) genetic disease as expansions of AGGGA repeats within the RFC1 gene are associated with the development of this neurodegenerative disorder. Interestingly, the RFC1 expanded motifs are pentanucleotides that differ from the nonpathogenic AGAAA pentanucleotide motif present in reference genomes. The molecular mechanisms underlying the pathogenicity of the mutated pentanucleotide expansion in CANVAS are still unknown. Several groups have shown that DNA and RNA containing AGGGA repeats fold into G-quadruplexes (G4s) under physiological K\u207a conditions. In this study, we reveal a more complex than expected behavior, in which DNA WGGGW motifs (where W is A or T) may adopt different G4 and non-G4 structures depending on sequence, repeat number and ionic conditions. These findings are relevant as they may help explain the genomic instability and pathogenicity specifically associated with AGGGA repeats among the WGGGW motifs.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41614301" +}, +{ + "id": "pmid:41592538", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41592538", + "title": "RFC1 Repeat Expansion in Chronic Cough: Findings From the Korean Chronic Cough Registry.", + "type": "article-journal", + "doi": "10.4168/aair.2026.18.1.55", + "authors": [ + ["Kyung Eun", "Park"], + ["Jiwon", "Lee"], + ["Jun-Pyo", "Choi"], + ["Ji-Yoon", "Oh"], + ["Ha-Kyeong", "Won"], + ["Hwa Young", "Lee"], + ["Surinder S", "Birring"], + ["Heung-Woo", "Park"], + ["Sang Heon", "Cho"], + ["Woo-Jung", "Song"] + ], + "publisher": "Allergy, asthma & immunology research", + "issn": "2092-7355", + "date": "2026-01-01", + "abstract": "Biallelic repeat expansions in the Replication Factor C Subunit 1 (", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41592538" +}, +{ + "id": "pmid:41532091", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41532091", + "title": "Efficacy of morphine on cough in patients with repeat expansions of", + "type": "article-journal", + "doi": "10.1183/23120541.00840-2025", + "authors": [ + ["Laurent", "Guilleminault"], + ["Pauline", "Chazelas"], + ["Corinne", "Magdelaine"], + ["Thomas", "Villeneuve"], + ["Anne-Sophie", "Lia"], + ["Laurent", "Magy"] + ], + "publisher": "ERJ open research", + "issn": "2312-0541", + "date": "2026-01-12", + "abstract": "", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41532091" +}, +{ + "id": "pmid:41607489", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41607489", + "title": "Minoxidil restores thymic growth in 22q11.2 deletion syndrome by limiting Sox9", + "type": "article-journal", + "doi": "10.70962/jhi.20250143", + "authors": [ + ["Pratibha", "Bhalla"], + ["Neha", "Ahuja"], + ["Ashwani", "Kumar"], + ["Chao", "Xing"], + ["Angela", "Moses"], + ["Ashutosh", "Shukla"], + ["Katelyn", "Boetel"], + ["Bret M", "Evers"], + ["John M", "Shelton"], + ["Maria Teresa", "de la Morena"], + ["Christian A", "Wysocki"], + ["Ondine B", "Cleaver"], + ["Nicolai S C", "van Oers"] + ], + "publisher": "Journal of human immunity", + "issn": "3065-8993", + "date": "2025-08-12", + "abstract": "Thymic hypoplasia, hypoparathyroidism, and cardiac defects are common congenital malformations caused by 22q11.2 deletion syndrome (22q11.2DS; aka DiGeorge syndrome). Thymus hypoplasia reduces peripheral T cell numbers, leading to more frequent infections. We report that embryonic hypoplastic thymuses from mouse models of 22q11.2DS (Tbx1", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41607489" +}, +{ + "id": "pmid:41562921", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41562921", + "title": "Longitudinal Study of", + "type": "article-journal", + "doi": "10.3390/medsci14010031", + "authors": [ + ["Jasmin X J", "Teo"], + ["Dawn J H", "Neo"], + ["Jessica Q H", "Choo"], + ["Xin", "Gong"], + ["Zheng", "Li"], + ["Hla Myint", "Htoon"], + ["Min Jie", "Chua"], + ["Yu Qiang", "Soh"], + ["V Vinod", "Mootha"], + ["Chiea Chuen", "Khor"], + ["Jodhbir S", "Mehta"] + ], + "publisher": "Medical sciences (Basel, Switzerland)", + "issn": "2076-3271", + "date": "2026-01-07", + "abstract": "", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41562921" +}, +{ + "id": "pmid:41533935", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41533935", + "title": "Protective Effects of Estradiol on Disease Progression in a Murine Model of Fuchs Endothelial Corneal Dystrophy.", + "type": "article-journal", + "doi": "10.1167/iovs.66.15.64", + "authors": [ + ["Itsuki", "Oka"], + ["Sohya", "Fujimoto"], + ["Tomohiro", "Fukui"], + ["Kota", "Mayumi"], + ["Theofilos", "Tourtas"], + ["Ursula", "Schl\u00f6tzer-Schrehardt"], + ["Friedrich", "Kruse"], + ["Albert S", "Jun"], + ["Noriko", "Koizumi"], + ["Naoki", "Okumura"] + ], + "publisher": "Investigative ophthalmology & visual science", + "issn": "1552-5783", + "date": "2025-12-01", + "abstract": "The purpose of this study was to investigate the protective effects of estradiol (E2) on disease progression in Fuchs endothelial corneal dystrophy (FECD) and to explore potential underlying mechanisms.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41533935" +}, +{ + "id": "pmid:41507280", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41507280", + "title": "Genotype-phenotype correlations in breast cancer susceptibility: evaluating MMP-2, TYMS, and eNOS variants in the Jordanian population.", + "type": "article-journal", + "doi": "10.1038/s41598-025-34531-0", + "authors": [ + ["Mohammed", "Alorjani"], + ["Laith", "Al-Eitan"], + ["Haneen", "Ali"], + ["Malek", "Ghabbish"] + ], + "publisher": "Scientific reports", + "issn": "2045-2322", + "date": "2026-01-08", + "abstract": "Breast cancer (BC) is a complex, polygenic, and heterogeneous disease influenced by both genetic and environmental factors. Several genetic polymorphisms, including single nucleotide variants (SNVs) and variable number tandem repeats (VNTRs), have been implicated in BC susceptibility and prognosis across diverse populations. This study aimed to assess the association between genetic variants in the MMP-2, TYMS, and eNOS genes and breast cancer risk in the Jordanian population. A case-control study was conducted involving 300 BC patients and 321 healthy controls. Genotyping was performed using conventional PCR and PCR-RFLP techniques to analyze one SNV in MMP-2 (rs2285053) and two VNTRs in TYMS (rs45445694) and eNOS. The MMP-2 SNV (rs2285053) and TYMS VNTR (rs45445694) showed significant associations with increased BC risk, whereas the eNOS VNTR exhibited no significant correlation. Significant genetic associations were identified under the co-dominant and recessive models, particularly for the T/T and C/T genotypes compared with C/C. No significant relationship was found between these variants and patient survival; however, TYMS mRNA expression was significantly associated with survival probability (p\u2009=\u20090.0185). Overall, these findings suggest that MMP-2 and TYMS variants contribute to breast cancer susceptibility among Jordanians, with TYMS expression serving as a potential prognostic biomarker.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41507280" +}, +{ + "id": "omim:309548", + "manubot_success": false, + "link": "https://omim.org/entry/309548", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/309548. Skipping" +}, +{ + "id": "omim:309510", + "manubot_success": false, + "link": "https://omim.org/entry/309510", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/309510. Skipping" +}, +{ + "id": "omim:308350", + "manubot_success": false, + "link": "https://omim.org/entry/308350", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/308350. Skipping" +}, +{ + "id": "omim:300004", + "manubot_success": false, + "link": "https://omim.org/entry/300004", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/300004. Skipping" +}, +{ + "id": "omim:300215", + "manubot_success": false, + "link": "https://omim.org/entry/300215", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/300215. Skipping" +}, +{ + "id": "omim:183090", + "manubot_success": false, + "link": "https://omim.org/entry/183090", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/183090. Skipping" +}, +{ + "id": "omim:164500", + "manubot_success": false, + "link": "https://omim.org/entry/164500", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/164500. Skipping" +}, +{ + "id": "omim:608768", + "manubot_success": false, + "link": "https://omim.org/entry/608768", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/608768. Skipping" +}, +{ + "id": "omim:117210", + "manubot_success": false, + "link": "https://omim.org/entry/117210", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/117210. Skipping" +}, +{ + "id": "omim:105500", + "manubot_success": false, + "link": "https://omim.org/entry/105500", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/105500. Skipping" +}, +{ + "id": "omim:147791", + "manubot_success": false, + "link": "https://omim.org/entry/147791", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/147791. Skipping" +}, +{ + "id": "omim:615945", + "manubot_success": false, + "link": "https://omim.org/entry/615945", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/615945. Skipping" +}, +{ + "id": "omim:136630", + "manubot_success": false, + "link": "https://omim.org/entry/136630", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/136630. Skipping" +}, +{ + "id": "omim:229300", + "manubot_success": false, + "link": "https://omim.org/entry/229300", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/229300. Skipping" +}, +{ + "id": "omim:618940", + "manubot_success": false, + "link": "https://omim.org/entry/618940", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/618940. Skipping" +}, +{ + "id": "omim:618412", + "manubot_success": false, + "link": "https://omim.org/entry/618412", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/618412. Skipping" +}, +{ + "id": "omim:186000", + "manubot_success": false, + "link": "https://omim.org/entry/186000", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/186000. Skipping" +}, +{ + "id": "omim:164310", + "manubot_success": false, + "link": "https://omim.org/entry/164310", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/164310. Skipping" +}, +{ + "id": "omim:613608", + "manubot_success": false, + "link": "https://omim.org/entry/613608", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/613608. Skipping" +}, +{ + "id": "omim:609893", + "manubot_success": false, + "link": "https://omim.org/entry/609893", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/609893. Skipping" +}, +{ + "id": "omim:105400", + "manubot_success": false, + "link": "https://omim.org/entry/105400", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/105400. Skipping" +}, +{ + "id": "omim:614153", + "manubot_success": false, + "link": "https://omim.org/entry/614153", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/614153. Skipping" +}, +{ + "id": "omim:603472", + "manubot_success": false, + "link": "https://omim.org/entry/603472", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/603472. Skipping" +}, +{ + "id": "omim:618637", + "manubot_success": false, + "link": "https://omim.org/entry/618637", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/618637. Skipping" +}, +{ + "id": "omim:601846", + "manubot_success": false, + "link": "https://omim.org/entry/601846", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/601846. Skipping" +}, +{ + "id": "omim:258450", + "manubot_success": false, + "link": "https://omim.org/entry/258450", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/258450. Skipping" +}, +{ + "id": "omim:157640", + "manubot_success": false, + "link": "https://omim.org/entry/157640", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/157640. Skipping" +}, +{ + "id": "omim:604326", + "manubot_success": false, + "link": "https://omim.org/entry/604326", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/604326. Skipping" +}, +{ + "id": "omim:616488", + "manubot_success": false, + "link": "https://omim.org/entry/616488", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/616488. Skipping" +}, +{ + "id": "omim:601068", + "manubot_success": false, + "link": "https://omim.org/entry/601068", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/601068. Skipping" +}, +{ + "id": "omim:300123", + "manubot_success": false, + "link": "https://omim.org/entry/300123", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/300123. Skipping" +}, +{ + "id": "omim:607136", + "manubot_success": false, + "link": "https://omim.org/entry/607136", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/607136. Skipping" +}, +{ + "id": "omim:187500", + "manubot_success": false, + "link": "https://omim.org/entry/187500", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/187500. Skipping" +}, +{ + "id": "omim:613267", + "manubot_success": false, + "link": "https://omim.org/entry/613267", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/613267. Skipping" +}, +{ + "id": "omim:619216", + "manubot_success": false, + "link": "https://omim.org/entry/619216", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/619216. Skipping" +}, +{ + "id": "omim:600223", + "manubot_success": false, + "link": "https://omim.org/entry/600223", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/600223. Skipping" +}, +{ + "id": "omim:314390", + "manubot_success": false, + "link": "https://omim.org/entry/314390", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/314390. Skipping" +}, +{ + "id": "omim:616181", + "manubot_success": false, + "link": "https://omim.org/entry/616181", + "note": "WARNING: Manubot does not support url:https://omim.org/entry/616181. Skipping" +}, +{ + "id": "malacard:KNS007", + "manubot_success": false, + "link": "https://www.malacards.org/card/KNS007", + "note": "WARNING: Manubot could not generate citation: Command '['manubot', 'cite', 'url:https://www.malacards.org/card/KNS007']' timed out after 3 seconds" +}, +{ + "id": "pmid:41564929", + "manubot_success": true, + "link": "https://www.ncbi.nlm.nih.gov/pubmed/41564929", + "title": "The alternative androgen receptor isoform A mitigates toxicity of polyglutamine-elongated mutant androgen receptor in spinal and bulbar muscular atrophy.", + "type": "article-journal", + "doi": "10.1016/j.jare.2026.01.051", + "authors": [ + ["Marta", "Chierichetti"], + ["Roberta", "Andreotti"], + ["Barbara", "Tedesco"], + ["Veronica", "Ferrari"], + ["Laura", "Cornaggia"], + ["Paola", "Pramaggiore"], + ["Marta", "Cozzi"], + ["Ali", "Mohamed"], + ["Rocio", "Magdalena"], + ["Margherita", "Piccolella"], + ["Giulia", "Boarolo"], + ["Valeria", "Crippa"], + ["Paola", "Rusmini"], + ["Mariarita", "Galbiati"], + ["Carlo", "Rinaldi"], + ["Eric N", "Anderson"], + ["Udai Bhan", "Pandey"], + ["Maria", "Pennuto"], + ["Riccardo", "Cristofani"], + ["Angelo", "Poletti"] + ], + "publisher": "Journal of advanced research", + "issn": "2090-1224", + "date": "2026-01-19", + "abstract": "Spinal and bulbar muscular atrophy (SBMA) is an X-linked neuromuscular disease caused by a CAG-repeat expansion in the androgen receptor (AR) gene, translated into an elongated polyglutamine (polyQ) tract in the protein. Androgens trigger ARpolyQ toxicity, thus most potential therapeutic approaches involve androgen reduction or AR negative modulation, with severe endocrine side effects.", + "language": "en", + "note": "This CSL Item was generated by Manubot v0.6.1 from its persistent identifier (standard_id).\nstandard_id: pubmed:41564929" +}, +{ + "id": "pmid:25101480", + "manubot_success": false, + "link": "https://pubmed.ncbi.nlm.nih.gov/25101480", + "note": "WARNING: Couldn't parse Manubot response: list index out of range" +}, +{ + "id": "pmid:29939637", + "manubot_success": false, + "link": "https://pubmed.ncbi.nlm.nih.gov/29939637", + "note": "WARNING: Couldn't parse Manubot response: list index out of range" +}, +{ + "id": "pmid:39666847", +======= "id": "omim:309548", +>>>>>>> f0de919 (Update Literature (#321)) "manubot_success": false, "link": "https://omim.org/entry/309548", "note": "WARNING: Manubot does not support url:https://omim.org/entry/309548. Skipping" diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index ccf8dfc9..899baaa8 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -72,10 +72,10 @@ "stop_hg19": 147582273, "start_t2t": 146765190, "stop_t2t": 146765342, - "disease": "Fragile X syndrome, FRAXE type", + "disease": "Intellectual developmental disorder, Fragile X intellectual disability", "inheritance": ["XR"], - "disease_description": "A nonsyndromic X-linked mental retardation (NS-XLMR) characterized by mild intellectual deficit. FRAXE is the most common form of NS-XLMR [@mondo:0010659].", - "hpo_terms": null, + "disease_description": "A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659].", + "hpo_terms": ["HP:0000718 Aggressive behavior", "HP:0000713 Agitation", "HP:0000729 Autistic behavior", "HP:0002312 Clumsiness", "HP:0000722 Compulsive behaviors", "HP:0000750 Delayed speech and language development", "HP:0001249 Intellectual disability"], "prevalence": "2/50000", "prevalence_details": "1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464].", "age_onset": "Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548].", @@ -926,8 +926,8 @@ "benign_min": 2, "benign_max": 23, "intermediate_min": 24, - "intermediate_max": 60, - "pathogenic_min": 251, + "intermediate_max": 30, + "pathogenic_min": 31, "pathogenic_max": 4088, "motif_len": 6, "ref_copies": 10.8, @@ -1634,10 +1634,10 @@ "gene_strand": "-", "reference_motif_reference_orientation": ["GAA"], "pathogenic_motif_reference_orientation": ["GAA"], - "benign_motif_reference_orientation": ["GAAGGA", "GAAGAAGAAGAAGCA"], + "benign_motif_reference_orientation": ["GGA", "GCA"], "unknown_motif_reference_orientation": [], "pathogenic_motif_gene_orientation": ["CTT"], - "benign_motif_gene_orientation": ["CCTTCT", "CTGCTTCTTCTTCTT"], + "benign_motif_gene_orientation": ["CCT", "CTG"], "unknown_motif_gene_orientation": [], "locus_structure": [], "benign_min": 8, @@ -1679,7 +1679,7 @@ "stop_t2t": 146176769, "disease": "Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1", "inheritance": ["XD"], - "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X mental retardation 1 protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].", + "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X messenger ribonucleoprotein 1 (FMR1) protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].", "hpo_terms": null, "prevalence": "14/100000", "prevalence_details": "Incidence of full mutation in males 19/100,000; prevalence 14/100,000 [@genereviews:NBK1384]. Female prevalence 9/100,000 [@pmid:24700618]. Known carrier frequency is approximately 300-500/100,000 but detected was 11/100,000 [@pmid:29100084]. FXS prevalence 1:7000 males, 1:11,000 females; FX premutation carriers 1:290-855 males, 1:148-300 females [@isbn:978-3-031-66932-3]. Found worldwide [@genereviews:NBK1384]. In Thailand, 1 in 600 women carry a premutation, and 1 in 400 carry a 'gray zone' allele [@pmid:39320553].", @@ -1688,9 +1688,9 @@ "age_onset_max": 78.0, "typ_age_onset_min": 1.0, "typ_age_onset_max": 65.0, - "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108].", + "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108]. Women with the premutation have been reported showing episodic memory deficits, similar to those seen in AD [@pmid:41555826].", "mechanism": "LoF/GoF", - "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768].", + "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768]. PRKGG appears to modulate neurotoxicity [@pmid:41507195].", "year": "1992 [@pmid:1605194]; causative gene discovered in 1991 [@pmid:1710175]", "location_in_gene": "5' UTR", "gene_strand": "+", @@ -1884,9 +1884,9 @@ "age_onset_max": 70.0, "typ_age_onset_min": 20.0, "typ_age_onset_max": 34.0, - "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784].", + "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Findings suggest that alternative initiation sites and an upstream CTG codon serve as the initiation site for RAN translation [@pmid:41121761]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784].", "mechanism": "LoF/GoF?", - "mechanism_detail": "RNA mediated toxicity hypothesized [@omim:618940], still unknown [@pmid:36169768].", + "mechanism_detail": "Findings suggest that the mechanism is likely not LoF, but the mechanism is otherwise unknown [@pmid:41121761]. This expansion appears to be predominantly RAN translated into a toxic protein [@pmid:41121761]. This protein has been reported to impair cell proliferation, induce cytotoxicity and apoptosis in multiple cell lines, and caused phenotypic defects in a zebrafish model [@pmid:41121761].", "year": "2020 [@pmid:32413282]", "location_in_gene": "5' UTR", "gene_strand": "-", @@ -2838,9 +2838,9 @@ "stop_hg19": 145209354, "start_t2t": 148519695, "stop_t2t": 148519738, - "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3", + "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6", "inheritance": ["AD"], - "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327].", + "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.", "hpo_terms": null, "prevalence": null, "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].", @@ -2851,7 +2851,7 @@ "typ_age_onset_max": 70.0, "details": "Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats [@genereviews:NBK535148]. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype [@pmid:39055960; @pmid:39496005]: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders [@pmid:31178126]. Age of onset inversely related to allele size [@pmid:38377026]. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype [@pmid:34718964]. Interruptions documented: GGA, GGG [@pmid:35245110]; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed [@pmid:38467784]. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.", "mechanism": "GoF", - "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@doi:10.1186/s12964-025-02079-1].", + "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@doi:10.1186/s12964-025-02079-1]. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported [@pmid:41539185].", "year": "2019 [@pmid:31332380]", "location_in_gene": "5' UTR", "gene_strand": "+", @@ -3026,7 +3026,7 @@ "stop_t2t": 41719805, "disease": "Congenital central hypoventilation syndrome", "inheritance": ["AD"], - "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of PHOX-2B gene is found in 90% of the patients. Association with a Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026].", + "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of PHOX-2B gene is found in 90% of the patients. Association with a Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026]. Hyperinsulinism has been observed in patients [@pmid:41531556].", "hpo_terms": null, "prevalence": null, "prevalence_details": "Incidence is 1:148000-200000 births (Estimated, may include mild/undiagnosed or be overestimated globally) [@genereviews:NBK1427]. Rare, but reported worldwide [@pmid:15121777].", @@ -3583,12 +3583,12 @@ "location_in_gene": "Intron 2", "gene_strand": "-", "reference_motif_reference_orientation": ["AAAAG"], - "pathogenic_motif_reference_orientation": ["AAGGG", "ACAGG", "AGGGC", "AAGGC", "AGAGG"], - "benign_motif_reference_orientation": ["AAAAG", "AAAGG", "AAGAG", "AAAGGG"], - "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AACGG", "AAGAC", "AAGGT", "AGAAC", "AGGGG", "GAAAC", "GGGAC", "GTGAG", "AAAAGA", "AAAGGA", "GGAAAG"], - "pathogenic_motif_gene_orientation": ["CCCTT", "CCTGT", "CCCTG", "CCTTG", "CCTCT"], - "benign_motif_gene_orientation": ["CTTTT", "CCTTT", "CTCTT", "CCCTTT"], - "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "CCGTT", "CTTGT", "ACCTT", "CTGTT", "CCCCT", "CGTTT", "CCCGT", "ACCTC", "CTTTTT", "CCTTTT", "CCCTTT"], + "pathogenic_motif_reference_orientation": ["AAGGG", "ACAGG", "AAAGG", "AGGGC"], + "benign_motif_reference_orientation": ["AAAAG", "AAAGGG"], + "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AACGG", "AAGAC", "AAGGT", "AGGGG", "AAGAG", "AAAAGG", "AAACG", "AACAG", "AGGTG", "ACGGG", "AAAAAG", "AAGGC"], + "pathogenic_motif_gene_orientation": ["CCCTT", "CCTGT", "CCTTT", "CCCTG"], + "benign_motif_gene_orientation": ["CTTTT", "CCCTTT"], + "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "CCGTT", "CTTGT", "ACCTT", "CCCCT", "CTCTT", "CCTTTT", "CGTTT", "CTGTT", "ACCTC", "CCCGT", "CTTTTT", "CCTTG"], "locus_structure": [ { "motif": "AAAAG", @@ -3823,8 +3823,8 @@ "additional_literature": ["pmid:41426430", "pmid:41219789", "pmid:38961870", "pmid:38467733", "pmid:38059543", "pmid:37592133", "pmid:36740228", "pmid:36622139", "pmid:36092952", "pmid:33791773", "pmid:33721773", "pmid:33681653", "pmid:33501421", "pmid:33040085", "pmid:32973343", "pmid:32203200", "pmid:32194077", "pmid:32174879", "pmid:31664039", "pmid:31483537", "pmid:30559482", "pmid:30351492", "pmid:30194086"] }, { - "id": "XLMR_SOX3", - "disease_id": "XLMR", + "id": "XLID_SOX3", + "disease_id": "XLID, PHPX", "gene": "SOX3", "chrom": "chrX", "start_hg38": 140504316, @@ -3833,7 +3833,7 @@ "stop_hg19": 139586526, "start_t2t": 138816203, "stop_t2t": 138816248, - "disease": "X-linked panhypopituitarism ; X-linked mental retardation with isolated growth hormone", + "disease": "X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX)", "inheritance": ["XR"], "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without intellectual disability [@pmid:24346842].", "hpo_terms": null, @@ -3844,7 +3844,7 @@ "age_onset_max": 9.0, "typ_age_onset_min": null, "typ_age_onset_max": null, - "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148].", + "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148]. There is phenotypic and allelic overlap between XLID and PHPX, with the pathogenic thresold for XLID estimated at 26 motifs and the pathogenic threshold for PHPX estimated at 22 motifs [@pmid:15800844, @pmid:12428212].", "mechanism": "LoF", "mechanism_detail": "Polyalanine expansions leading to aggresome formation and impaired transcriptional activity [@pmid:17127446].", "year": "2002 [@pmid:12428212]", diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed index 192ac6d9..b5c535c4 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed @@ -13,7 +13,7 @@ chr3 131917482 131917635 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC= chr3 141687011 141687054 ID=BPES_FOXL2;MOTIFS=NGC;STRUC= chr3 186521667 186521706 ID=FAME4_YEATS2;MOTIFS=TTTTA,TTTCA;STRUC= chr4 3073603 3073723 ID=HD_HTT;MOTIFS=CAG,CCG;STRUC= -chr4 39318077 39318136 ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG;STRUC= +chr4 39318077 39318136 ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG;STRUC= chr4 41719745 41719805 ID=CCHS_PHOX2B;MOTIFS=GCN;STRUC= chr4 162693303 162693405 ID=FAME7_RAPGEF2;MOTIFS=TTTTA,TTTCA;STRUC= chr5 10295525 10295593 ID=FAME3_MARCHF6;MOTIFS=TTTTA,TTTCA;STRUC= @@ -38,7 +38,7 @@ chr12 111575873 111575940 ID=SCA2_ATXN2;MOTIFS=CTG;STRUC= chr12 123532573 123532603 ID=OPDM4_RILPL1;MOTIFS=GGC;STRUC= chr13 69361213 69361270 ID=SCA8_ATXN8OS;MOTIFS=CTA,CTG;STRUC= chr13 99196358 99196404 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC= -chr13 101377549 101377792 ID=SCA27B_FGF14;MOTIFS=GAA,GAAGGA,GAAGAAGAAGAAGCA;STRUC= +chr13 101377549 101377792 ID=SCA27B_FGF14;MOTIFS=GAA,GGA,GCA;STRUC= chr14 17522488 17522519 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC= chr14 86300519 86300603 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC= chr15 20458510 20458536 ID=ALS1_NIPA1;MOTIFS=GCG;STRUC= @@ -70,6 +70,6 @@ chrX 30882677 30882751 ID=DMD_DMD;MOTIFS=TTC,T;STRUC= chrX 65975147 65975250 ID=SBMA_AR;MOTIFS=GCA;STRUC= chrX 69887153 69887230 ID=XDP_TAF1;MOTIFS=AGAGGG;STRUC= chrX 135876774 135876804 ID=VACTERLX_ZIC3;MOTIFS=GCN;STRUC= -chrX 138816203 138816248 ID=XLMR_SOX3;MOTIFS=NGC;STRUC= +chrX 138816203 138816248 ID=XLID_SOX3;MOTIFS=NGC;STRUC= chrX 146176677 146176769 ID=FXS_FMR1;MOTIFS=CGG;STRUC= chrX 146765190 146765342 ID=FRAXE_AFF2;MOTIFS=GCC;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed index 86e42039..15894f9a 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed @@ -82,6 +82,6 @@ chrX 30882743 30882751 T 1 DMD_DMD_flank chrX 65975147 65975250 GCA 3 SBMA_AR chrX 69887153 69887230 AGAGGG 6 XDP_TAF1 chrX 135876774 135876804 GCN 3 VACTERLX_ZIC3 -chrX 138816203 138816248 NGC 3 XLMR_SOX3 +chrX 138816203 138816248 NGC 3 XLID_SOX3 chrX 146176677 146176769 CGG 3 FXS_FMR1 chrX 146765190 146765342 GCC 3 FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz index abee0b5a..6311b1db 100644 Binary files a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz and b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz differ diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed index 41339dcd..b87df8b6 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed @@ -2,7 +2,7 @@ chr1 870158 870178 HMNR7_VWA1 VWA1 GGCGCGGAGC GGCGCGGAGC 1 AR Neuronopathy, distal hereditary motor, autosomal recessive 7 chr1 57245935 57245973 SCA37_DAB1 DAB1 AAAAT GAAAT 31 AD Spinocerebellar ataxia type 37 chr1 94266544 94266567 OPDM5_ABCD3 ABCD3 GCC GCC 118 AD Oculopharyngodistal myopathy type 5 -chr1 148519695 148519738 NIID_NOTCH2NLC NOTCH2NLC GGC GGC 66 AD Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3 +chr1 148519695 148519738 NIID_NOTCH2NLC NOTCH2NLC GGC GGC 66 AD Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6 chr1 154328121 154330802 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA None AD Autosomal dominant tubulointerstitial kidney disease chr1 155728131 155728159 NME_NAXE NAXE GGGCC GGGCC 200 AR NAXE-related mitochondrial encephalopathy chr2 96703674 96703732 FAME2_STARD7 STARD7 AAAAT AAATG 274 AD Familial adult myoclonic epilepsy 2 @@ -14,7 +14,7 @@ chr3 131917482 131917557 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 chr3 141687011 141687054 BPES_FOXL2 FOXL2 NGC NGC 15 AD,AR Blepharophimosis, epicanthus inversus, and ptosis chr3 186521667 186521706 FAME4_YEATS2 YEATS2 TTTTA TTTCA 1000 AD Familial adult myoclonic epilepsy 4 chr4 3073603 3073687 HD_HTT HTT CAG CAG 36 AD Huntington disease -chr4 39318077 39318136 CANVAS_RFC1 RFC1 AAAAG AAGGG,ACAGG,AGGGC,AAGGC,AGAGG 400 AR Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome +chr4 39318077 39318136 CANVAS_RFC1 RFC1 AAAAG AAGGG,ACAGG,AAAGG,AGGGC 400 AR Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome chr4 41719745 41719805 CCHS_PHOX2B PHOX2B GCN GCN 26 AD Congenital central hypoventilation syndrome chr4 162693303 162693405 FAME7_RAPGEF2 RAPGEF2 TTTTA TTTCA 60 AD Familial adult myoclonic epilepsy type 7 chr5 10295525 10295593 FAME3_MARCHF6 MARCHF6 TTTTA TTTCA 650 AD Familial adult myoclonic epilepsy type 3 @@ -28,7 +28,7 @@ chr7 27335912 27335954 HFG_HOXA13-I HOXA13 NGC NGC 22 AD Hand-foot-genital syndr chr7 56047900 56047939 FRA7A_ZNF713 ZNF713 GCG GCG 450 AD Autism spectrum disorder associated with fragile site FRA7A chr8 105716409 105716441 OPDM1_LRP12 LRP12 CGC CGC 85 AD Oculopharyngodistal myopathy type 1 chr8 119495247 119495353 FAME1_SAMD12 SAMD12 TAAAA TGAAA 105 AD Familial adult myoclonic epilepsy type 1 -chr9 27584063 27584155 FTDALS1_C9orf72 C9orf72 GGCCCC GGCCCC 251 AD Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) +chr9 27584063 27584155 FTDALS1_C9orf72 C9orf72 GGCCCC GGCCCC 31 AD Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) chr9 81210834 81210861 FRDA_FXN FXN GAA GAA 56 AR Friedreich ataxia chr9 142886568 142886595 HSAN-VIII_PRDM12 PRDM12 GCC GCC 18 AR Hereditary sensory and autonomic neuropathy type VIII chr10 80695718 80695748 OPML1_NUTM2B-AS1 NUTM2B-AS1 GGC GGC 161 AD Oculopharyngeal myopathy with leukoencephalopathy 1 @@ -71,6 +71,6 @@ chrX 30882677 30882743 DMD_DMD DMD TTC TTC 59 XR Duchenne muscular dystrophy chrX 65975147 65975250 SBMA_AR AR GCA GCA 38 XR Spinal and bulbar muscular atrophy, Kennedy Disease chrX 69887153 69887230 XDP_TAF1 TAF1 AGAGGG AGAGGG 35 XR X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3) chrX 135876774 135876804 VACTERLX_ZIC3 ZIC3 GCN GCN 12 XR X-linked VACTERL syndrome -chrX 138816203 138816248 XLMR_SOX3 SOX3 NGC NGC 22 XR X-linked panhypopituitarism ; X-linked mental retardation with isolated growth hormone +chrX 138816203 138816248 XLID_SOX3 SOX3 NGC NGC 22 XR X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX) chrX 146176677 146176769 FXS_FMR1 FMR1 CGG CGG 201 XD Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1 -chrX 146765190 146765342 FRAXE_AFF2 AFF2 GCC GCC 201 XR Fragile X syndrome, FRAXE type +chrX 146765190 146765342 FRAXE_AFF2 AFF2 GCC GCC 201 XR Intellectual developmental disorder, Fragile X intellectual disability diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed index c36c8a4d..f5b2f6ad 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed @@ -13,7 +13,7 @@ chr3 131917483 131917557 CAGG DM2_CNBP chr3 141687012 141687054 NGC BPES_FOXL2 chr3 186521668 186521706 TTTCA,TTTTA FAME4_YEATS2 chr4 3073604 3073687 CAG HD_HTT -chr4 39318078 39318136 AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAAG,AAAGG,AAGAG,AAAGGG CANVAS_RFC1 +chr4 39318078 39318136 AAGGG,ACAGG,AAAGG,AGGGC,AAAAG,AAAGGG CANVAS_RFC1 chr4 41719746 41719805 GCN CCHS_PHOX2B chr4 162693304 162693405 TTTCA,TTTTA FAME7_RAPGEF2 chr5 10295526 10295593 TTTCA,TTTTA FAME3_MARCHF6 @@ -38,7 +38,7 @@ chr12 111575874 111575940 CTG SCA2_ATXN2 chr12 123532574 123532603 GGC OPDM4_RILPL1 chr13 69361244 69361270 CTG SCA8_ATXN8OS chr13 99196359 99196404 GCN HPE5_ZIC2 -chr13 101377550 101377792 GAA,GAAGGA,GAAGAAGAAGAAGCA SCA27B_FGF14 +chr13 101377550 101377792 GAA,GGA,GCA SCA27B_FGF14 chr14 17522489 17522519 GCN OPMD_PABPN1 chr14 86300520 86300603 CTG SCA3_ATXN3 chr15 20458511 20458536 GCG ALS1_NIPA1 @@ -70,6 +70,6 @@ chrX 30882678 30882743 TTC DMD_DMD chrX 65975148 65975250 GCA SBMA_AR chrX 69887154 69887230 AGAGGG XDP_TAF1 chrX 135876775 135876804 GCN VACTERLX_ZIC3 -chrX 138816204 138816248 NGC XLMR_SOX3 +chrX 138816204 138816248 NGC XLID_SOX3 chrX 146176678 146176769 CGG FXS_FMR1 chrX 146765191 146765342 GCC FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed index 2f601147..b5c06f5e 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed @@ -80,6 +80,6 @@ chrX 30882743 30882751 T DMD_DMD DMD_DMD_T chrX 65975147 65975250 GCA SBMA_AR SBMA_AR chrX 69887153 69887230 AGAGGG XDP_TAF1 XDP_TAF1 chrX 135876774 135876804 GCN VACTERLX_ZIC3 VACTERLX_ZIC3 -chrX 138816203 138816248 NGC XLMR_SOX3 XLMR_SOX3 +chrX 138816203 138816248 NGC XLID_SOX3 XLID_SOX3 chrX 146176677 146176769 CGG FXS_FMR1 FXS_FMR1 chrX 146765190 146765342 GCC FRAXE_AFF2 FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json index c24a0a9d..8c90cd18 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json @@ -393,7 +393,7 @@ "DisplayRU": "GGCCCC", "Disease": "FTDALS1", "NormalMax": 23, - "PathologicMin": 251, + "PathologicMin": 31, "Gene": "C9orf72" }, { @@ -961,14 +961,14 @@ "Gene": "ZIC3" }, { - "LocusId": "XLMR_SOX3", + "LocusId": "XLID_SOX3", "ReferenceRegion": "chrX:138816203-138816248", "LocusStructure": "(NGC)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["XR"], "DisplayRU": "NGC", - "Disease": "XLMR", + "Disease": "XLID, PHPX", "NormalMax": 15, "PathologicMin": 22, "Gene": "SOX3" diff --git a/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed b/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed index ab47340c..257f76ba 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed @@ -13,7 +13,7 @@ chr3 128891419 128891577 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC= chr3 138664861 138664904 ID=BPES_FOXL2;MOTIFS=NGC;STRUC= chr3 183429975 183430014 ID=FAME4_YEATS2;MOTIFS=TTTTA,TTTCA;STRUC= chr4 3076603 3076696 ID=HD_HTT;MOTIFS=CAG,CCG;STRUC= -chr4 39350044 39350103 ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG;STRUC= +chr4 39350044 39350103 ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG;STRUC= chr4 41747989 41748049 ID=CCHS_PHOX2B;MOTIFS=GCN;STRUC= chr4 160263678 160263770 ID=FAME7_RAPGEF2;MOTIFS=TTTTA,TTTCA;STRUC= chr5 10356455 10356523 ID=FAME3_MARCHF6;MOTIFS=TTTTA,TTTCA;STRUC= @@ -38,7 +38,7 @@ chr12 112036753 112036823 ID=SCA2_ATXN2;MOTIFS=CTG;STRUC= chr12 124018267 124018297 ID=OPDM4_RILPL1;MOTIFS=GGC;STRUC= chr13 70713485 70713561 ID=SCA8_ATXN8OS;MOTIFS=CTA,CTG;STRUC= chr13 100637702 100637748 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC= -chr13 102813924 102814076 ID=SCA27B_FGF14;MOTIFS=GAA,GAAGGA,GAAGAAGAAGAAGCA;STRUC= +chr13 102813924 102814076 ID=SCA27B_FGF14;MOTIFS=GAA,GGA,GCA;STRUC= chr14 23790681 23790712 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC= chr14 92537354 92537396 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC= chr15 23086363 23086389 ID=ALS1_NIPA1;MOTIFS=GCG;STRUC= @@ -70,6 +70,6 @@ chrX 31302674 31302730 ID=DMD_DMD;MOTIFS=TTC,T;STRUC= chrX 66765158 66765261 ID=SBMA_AR;MOTIFS=GCA;STRUC= chrX 70672904 70672981 ID=XDP_TAF1;MOTIFS=AGAGGG;STRUC= chrX 136648985 136649015 ID=VACTERLX_ZIC3;MOTIFS=GCN;STRUC= -chrX 139586481 139586526 ID=XLMR_SOX3;MOTIFS=NGC;STRUC= +chrX 139586481 139586526 ID=XLID_SOX3;MOTIFS=NGC;STRUC= chrX 146993567 146993629 ID=FXS_FMR1;MOTIFS=CGG;STRUC= chrX 147582124 147582273 ID=FRAXE_AFF2;MOTIFS=GCC;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed index 78f66ecc..9ee8cc08 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed @@ -82,6 +82,6 @@ chrX 31302722 31302730 T 1 DMD_DMD_flank chrX 66765158 66765261 GCA 3 SBMA_AR chrX 70672904 70672981 AGAGGG 6 XDP_TAF1 chrX 136648985 136649015 GCN 3 VACTERLX_ZIC3 -chrX 139586481 139586526 NGC 3 XLMR_SOX3 +chrX 139586481 139586526 NGC 3 XLID_SOX3 chrX 146993567 146993629 CGG 3 FXS_FMR1 chrX 147582124 147582273 GCC 3 FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz index 98a3a488..8fbc9ad3 100644 Binary files a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz and b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz differ diff --git a/data/catalogs/STRchive-disease-loci.hg19.general.bed b/data/catalogs/STRchive-disease-loci.hg19.general.bed index 0dddc18d..fe9b7945 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.general.bed @@ -2,7 +2,7 @@ chr1 1371178 1371198 HMNR7_VWA1 VWA1 GGCGCGGAGC GGCGCGGAGC 1 AR Neuronopathy, distal hereditary motor, autosomal recessive 7 chr1 57832715 57832793 SCA37_DAB1 DAB1 AAAAT GAAAT 31 AD Spinocerebellar ataxia type 37 chr1 94883977 94884000 OPDM5_ABCD3 ABCD3 GCC GCC 118 AD Oculopharyngodistal myopathy type 5 -chr1 145209323 145209354 NIID_NOTCH2NLC NOTCH2NLC GGC GGC 66 AD Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3 +chr1 145209323 145209354 NIID_NOTCH2NLC NOTCH2NLC GGC GGC 66 AD Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6 chr1 155160981 155162030 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA None AD Autosomal dominant tubulointerstitial kidney disease chr1 156561557 156561575 NME_NAXE NAXE GGGCC GGGCC 200 AR NAXE-related mitochondrial encephalopathy chr2 96862804 96862862 FAME2_STARD7 STARD7 AAAAT AAATG 274 AD Familial adult myoclonic epilepsy 2 @@ -14,7 +14,7 @@ chr3 128891419 128891499 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 chr3 138664861 138664904 BPES_FOXL2 FOXL2 NGC NGC 15 AD,AR Blepharophimosis, epicanthus inversus, and ptosis chr3 183429975 183430014 FAME4_YEATS2 YEATS2 TTTTA TTTCA 1000 AD Familial adult myoclonic epilepsy 4 chr4 3076603 3076660 HD_HTT HTT CAG CAG 36 AD Huntington disease -chr4 39350044 39350103 CANVAS_RFC1 RFC1 AAAAG AAGGG,ACAGG,AGGGC,AAGGC,AGAGG 400 AR Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome +chr4 39350044 39350103 CANVAS_RFC1 RFC1 AAAAG AAGGG,ACAGG,AAAGG,AGGGC 400 AR Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome chr4 41747989 41748049 CCHS_PHOX2B PHOX2B GCN GCN 26 AD Congenital central hypoventilation syndrome chr4 160263678 160263770 FAME7_RAPGEF2 RAPGEF2 TTTTA TTTCA 60 AD Familial adult myoclonic epilepsy type 7 chr5 10356455 10356523 FAME3_MARCHF6 MARCHF6 TTTTA TTTCA 650 AD Familial adult myoclonic epilepsy type 3 @@ -28,7 +28,7 @@ chr7 27239543 27239585 HFG_HOXA13-I HOXA13 NGC NGC 22 AD Hand-foot-genital syndr chr7 55955293 55955332 FRA7A_ZNF713 ZNF713 GCG GCG 450 AD Autism spectrum disorder associated with fragile site FRA7A chr8 105601198 105601227 OPDM1_LRP12 LRP12 CGC CGC 85 AD Oculopharyngodistal myopathy type 1 chr8 119379051 119379157 FAME1_SAMD12 SAMD12 TAAAA TGAAA 105 AD Familial adult myoclonic epilepsy type 1 -chr9 27573482 27573544 FTDALS1_C9orf72 C9orf72 GGCCCC GGCCCC 251 AD Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) +chr9 27573482 27573544 FTDALS1_C9orf72 C9orf72 GGCCCC GGCCCC 31 AD Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) chr9 71652202 71652220 FRDA_FXN FXN GAA GAA 56 AR Friedreich ataxia chr9 133556992 133557028 HSAN-VIII_PRDM12 PRDM12 GCC GCC 18 AR Hereditary sensory and autonomic neuropathy type VIII chr10 81586139 81586160 OPML1_NUTM2B-AS1 NUTM2B-AS1 GGC GGC 161 AD Oculopharyngeal myopathy with leukoencephalopathy 1 @@ -71,6 +71,6 @@ chrX 31302674 31302722 DMD_DMD DMD TTC TTC 59 XR Duchenne muscular dystrophy chrX 66765158 66765261 SBMA_AR AR GCA GCA 38 XR Spinal and bulbar muscular atrophy, Kennedy Disease chrX 70672904 70672981 XDP_TAF1 TAF1 AGAGGG AGAGGG 35 XR X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3) chrX 136648985 136649015 VACTERLX_ZIC3 ZIC3 GCN GCN 12 XR X-linked VACTERL syndrome -chrX 139586481 139586526 XLMR_SOX3 SOX3 NGC NGC 22 XR X-linked panhypopituitarism ; X-linked mental retardation with isolated growth hormone +chrX 139586481 139586526 XLID_SOX3 SOX3 NGC NGC 22 XR X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX) chrX 146993567 146993629 FXS_FMR1 FMR1 CGG CGG 201 XD Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1 -chrX 147582124 147582273 FRAXE_AFF2 AFF2 GCC GCC 201 XR Fragile X syndrome, FRAXE type +chrX 147582124 147582273 FRAXE_AFF2 AFF2 GCC GCC 201 XR Intellectual developmental disorder, Fragile X intellectual disability diff --git a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed index 3ba18238..80681770 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed @@ -13,7 +13,7 @@ chr3 128891420 128891499 CAGG DM2_CNBP chr3 138664862 138664904 NGC BPES_FOXL2 chr3 183429976 183430014 TTTCA,TTTTA FAME4_YEATS2 chr4 3076604 3076660 CAG HD_HTT -chr4 39350045 39350103 AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAAG,AAAGG,AAGAG,AAAGGG CANVAS_RFC1 +chr4 39350045 39350103 AAGGG,ACAGG,AAAGG,AGGGC,AAAAG,AAAGGG CANVAS_RFC1 chr4 41747990 41748049 GCN CCHS_PHOX2B chr4 160263679 160263770 TTTCA,TTTTA FAME7_RAPGEF2 chr5 10356456 10356523 TTTCA,TTTTA FAME3_MARCHF6 @@ -38,7 +38,7 @@ chr12 112036754 112036823 CTG SCA2_ATXN2 chr12 124018268 124018297 GGC OPDM4_RILPL1 chr13 70713516 70713561 CTG SCA8_ATXN8OS chr13 100637703 100637748 GCN HPE5_ZIC2 -chr13 102813925 102814076 GAA,GAAGGA,GAAGAAGAAGAAGCA SCA27B_FGF14 +chr13 102813925 102814076 GAA,GGA,GCA SCA27B_FGF14 chr14 23790682 23790712 GCN OPMD_PABPN1 chr14 92537355 92537396 CTG SCA3_ATXN3 chr15 23086364 23086389 GCG ALS1_NIPA1 @@ -70,6 +70,6 @@ chrX 31302675 31302722 TTC DMD_DMD chrX 66765159 66765261 GCA SBMA_AR chrX 70672905 70672981 AGAGGG XDP_TAF1 chrX 136648986 136649015 GCN VACTERLX_ZIC3 -chrX 139586482 139586526 NGC XLMR_SOX3 +chrX 139586482 139586526 NGC XLID_SOX3 chrX 146993568 146993629 CGG FXS_FMR1 chrX 147582125 147582273 GCC FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed index 9e52fca2..d6b33f29 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed @@ -80,6 +80,6 @@ chrX 31302722 31302730 T DMD_DMD DMD_DMD_T chrX 66765158 66765261 GCA SBMA_AR SBMA_AR chrX 70672904 70672981 AGAGGG XDP_TAF1 XDP_TAF1 chrX 136648985 136649015 GCN VACTERLX_ZIC3 VACTERLX_ZIC3 -chrX 139586481 139586526 NGC XLMR_SOX3 XLMR_SOX3 +chrX 139586481 139586526 NGC XLID_SOX3 XLID_SOX3 chrX 146993567 146993629 CGG FXS_FMR1 FXS_FMR1 chrX 147582124 147582273 GCC FRAXE_AFF2 FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json index 9da2ed04..2395c3e5 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg19.stranger.json @@ -393,7 +393,7 @@ "DisplayRU": "GGCCCC", "Disease": "FTDALS1", "NormalMax": 23, - "PathologicMin": 251, + "PathologicMin": 31, "Gene": "C9orf72" }, { @@ -961,14 +961,14 @@ "Gene": "ZIC3" }, { - "LocusId": "XLMR_SOX3", + "LocusId": "XLID_SOX3", "ReferenceRegion": "chrX:139586481-139586526", "LocusStructure": "(NGC)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["XR"], "DisplayRU": "NGC", - "Disease": "XLMR", + "Disease": "XLID, PHPX", "NormalMax": 15, "PathologicMin": 22, "Gene": "SOX3" diff --git a/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed b/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed index 75c81b02..e1be0ca7 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed @@ -13,7 +13,7 @@ chr3 129172576 129172734 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC= chr3 138946019 138946062 ID=BPES_FOXL2;MOTIFS=NGC;STRUC= chr3 183712187 183712226 ID=FAME4_YEATS2;MOTIFS=TTTTA,TTTCA;STRUC= chr4 3074876 3074969 ID=HD_HTT;MOTIFS=CAG,CCG;STRUC= -chr4 39348424 39348483 ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG;STRUC= +chr4 39348424 39348483 ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG;STRUC= chr4 41745972 41746032 ID=CCHS_PHOX2B;MOTIFS=GCN;STRUC= chr4 159342526 159342618 ID=FAME7_RAPGEF2;MOTIFS=TTTTA,TTTCA;STRUC= chr5 10356343 10356411 ID=FAME3_MARCHF6;MOTIFS=TTTTA,TTTCA;STRUC= @@ -38,7 +38,7 @@ chr12 111598949 111599019 ID=SCA2_ATXN2;MOTIFS=CTG;STRUC= chr12 123533720 123533750 ID=OPDM4_RILPL1;MOTIFS=GGC;STRUC= chr13 70139353 70139429 ID=SCA8_ATXN8OS;MOTIFS=CTA,CTG;STRUC= chr13 99985448 99985494 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC= -chr13 102161574 102161726 ID=SCA27B_FGF14;MOTIFS=GAA,GAAGGA,GAAGAAGAAGAAGCA;STRUC= +chr13 102161574 102161726 ID=SCA27B_FGF14;MOTIFS=GAA,GGA,GCA;STRUC= chr14 23321472 23321503 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC= chr14 92071010 92071052 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC= chr15 22786677 22786703 ID=ALS1_NIPA1;MOTIFS=GCG;STRUC= @@ -70,6 +70,6 @@ chrX 31284557 31284613 ID=DMD_DMD;MOTIFS=TTC,T;STRUC= chrX 67545316 67545419 ID=SBMA_AR;MOTIFS=GCA;STRUC= chrX 71453054 71453131 ID=XDP_TAF1;MOTIFS=AGAGGG;STRUC= chrX 137566826 137566856 ID=VACTERLX_ZIC3;MOTIFS=GCN;STRUC= -chrX 140504316 140504361 ID=XLMR_SOX3;MOTIFS=NGC;STRUC= +chrX 140504316 140504361 ID=XLID_SOX3;MOTIFS=NGC;STRUC= chrX 147912049 147912111 ID=FXS_FMR1;MOTIFS=CGG;STRUC= chrX 148500604 148500753 ID=FRAXE_AFF2;MOTIFS=GCC;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed index 8311febd..a681be25 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed @@ -82,6 +82,6 @@ chrX 31284605 31284613 T 1 DMD_DMD_flank chrX 67545316 67545419 GCA 3 SBMA_AR chrX 71453054 71453131 AGAGGG 6 XDP_TAF1 chrX 137566826 137566856 GCN 3 VACTERLX_ZIC3 -chrX 140504316 140504361 NGC 3 XLMR_SOX3 +chrX 140504316 140504361 NGC 3 XLID_SOX3 chrX 147912049 147912111 CGG 3 FXS_FMR1 chrX 148500604 148500753 GCC 3 FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz index 23164d4e..dbffdc3a 100644 Binary files a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz and b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz differ diff --git a/data/catalogs/STRchive-disease-loci.hg38.general.bed b/data/catalogs/STRchive-disease-loci.hg38.general.bed index 961e3bab..e7a87b75 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.general.bed @@ -2,7 +2,7 @@ chr1 1435798 1435818 HMNR7_VWA1 VWA1 GGCGCGGAGC GGCGCGGAGC 1 AR Neuronopathy, distal hereditary motor, autosomal recessive 7 chr1 57367043 57367121 SCA37_DAB1 DAB1 AAAAT GAAAT 31 AD Spinocerebellar ataxia type 37 chr1 94418421 94418444 OPDM5_ABCD3 ABCD3 GCC GCC 118 AD Oculopharyngodistal myopathy type 5 -chr1 149390802 149390842 NIID_NOTCH2NLC NOTCH2NLC GGC GGC 66 AD Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3 +chr1 149390802 149390842 NIID_NOTCH2NLC NOTCH2NLC GGC GGC 66 AD Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6 chr1 155188505 155192239 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA None AD Autosomal dominant tubulointerstitial kidney disease chr1 156591765 156591783 NME_NAXE NAXE GGGCC GGGCC 200 AR NAXE-related mitochondrial encephalopathy chr2 96197066 96197124 FAME2_STARD7 STARD7 AAAAT AAATG 274 AD Familial adult myoclonic epilepsy 2 @@ -14,7 +14,7 @@ chr3 129172576 129172656 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 chr3 138946019 138946062 BPES_FOXL2 FOXL2 NGC NGC 15 AD,AR Blepharophimosis, epicanthus inversus, and ptosis chr3 183712187 183712226 FAME4_YEATS2 YEATS2 TTTTA TTTCA 1000 AD Familial adult myoclonic epilepsy 4 chr4 3074876 3074933 HD_HTT HTT CAG CAG 36 AD Huntington disease -chr4 39348424 39348483 CANVAS_RFC1 RFC1 AAAAG AAGGG,ACAGG,AGGGC,AAGGC,AGAGG 400 AR Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome +chr4 39348424 39348483 CANVAS_RFC1 RFC1 AAAAG AAGGG,ACAGG,AAAGG,AGGGC 400 AR Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome chr4 41745972 41746032 CCHS_PHOX2B PHOX2B GCN GCN 26 AD Congenital central hypoventilation syndrome chr4 159342526 159342618 FAME7_RAPGEF2 RAPGEF2 TTTTA TTTCA 60 AD Familial adult myoclonic epilepsy type 7 chr5 10356343 10356411 FAME3_MARCHF6 MARCHF6 TTTTA TTTCA 650 AD Familial adult myoclonic epilepsy type 3 @@ -28,7 +28,7 @@ chr7 27199924 27199966 HFG_HOXA13-I HOXA13 NGC NGC 22 AD Hand-foot-genital syndr chr7 55887600 55887639 FRA7A_ZNF713 ZNF713 GCG GCG 450 AD Autism spectrum disorder associated with fragile site FRA7A chr8 104588970 104588999 OPDM1_LRP12 LRP12 CGC CGC 85 AD Oculopharyngodistal myopathy type 1 chr8 118366812 118366918 FAME1_SAMD12 SAMD12 TAAAA TGAAA 105 AD Familial adult myoclonic epilepsy type 1 -chr9 27573484 27573546 FTDALS1_C9orf72 C9orf72 GGCCCC GGCCCC 251 AD Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) +chr9 27573484 27573546 FTDALS1_C9orf72 C9orf72 GGCCCC GGCCCC 31 AD Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) chr9 69037286 69037304 FRDA_FXN FXN GAA GAA 56 AR Friedreich ataxia chr9 130681605 130681641 HSAN-VIII_PRDM12 PRDM12 GCC GCC 18 AR Hereditary sensory and autonomic neuropathy type VIII chr10 79826383 79826404 OPML1_NUTM2B-AS1 NUTM2B-AS1 GGC GGC 161 AD Oculopharyngeal myopathy with leukoencephalopathy 1 @@ -71,6 +71,6 @@ chrX 31284557 31284605 DMD_DMD DMD TTC TTC 59 XR Duchenne muscular dystrophy chrX 67545316 67545419 SBMA_AR AR GCA GCA 38 XR Spinal and bulbar muscular atrophy, Kennedy Disease chrX 71453054 71453131 XDP_TAF1 TAF1 AGAGGG AGAGGG 35 XR X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3) chrX 137566826 137566856 VACTERLX_ZIC3 ZIC3 GCN GCN 12 XR X-linked VACTERL syndrome -chrX 140504316 140504361 XLMR_SOX3 SOX3 NGC NGC 22 XR X-linked panhypopituitarism ; X-linked mental retardation with isolated growth hormone +chrX 140504316 140504361 XLID_SOX3 SOX3 NGC NGC 22 XR X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX) chrX 147912049 147912111 FXS_FMR1 FMR1 CGG CGG 201 XD Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1 -chrX 148500604 148500753 FRAXE_AFF2 AFF2 GCC GCC 201 XR Fragile X syndrome, FRAXE type +chrX 148500604 148500753 FRAXE_AFF2 AFF2 GCC GCC 201 XR Intellectual developmental disorder, Fragile X intellectual disability diff --git a/data/catalogs/STRchive-disease-loci.hg38.longTR.bed b/data/catalogs/STRchive-disease-loci.hg38.longTR.bed index 8a36b988..18313db9 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.longTR.bed @@ -13,7 +13,7 @@ chr3 129172577 129172656 CAGG DM2_CNBP chr3 138946020 138946062 NGC BPES_FOXL2 chr3 183712188 183712226 TTTCA,TTTTA FAME4_YEATS2 chr4 3074877 3074933 CAG HD_HTT -chr4 39348425 39348483 AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAAG,AAAGG,AAGAG,AAAGGG CANVAS_RFC1 +chr4 39348425 39348483 AAGGG,ACAGG,AAAGG,AGGGC,AAAAG,AAAGGG CANVAS_RFC1 chr4 41745973 41746032 GCN CCHS_PHOX2B chr4 159342527 159342618 TTTCA,TTTTA FAME7_RAPGEF2 chr5 10356344 10356411 TTTCA,TTTTA FAME3_MARCHF6 @@ -38,7 +38,7 @@ chr12 111598950 111599019 CTG SCA2_ATXN2 chr12 123533721 123533750 GGC OPDM4_RILPL1 chr13 70139384 70139429 CTG SCA8_ATXN8OS chr13 99985449 99985494 GCN HPE5_ZIC2 -chr13 102161575 102161726 GAA,GAAGGA,GAAGAAGAAGAAGCA SCA27B_FGF14 +chr13 102161575 102161726 GAA,GGA,GCA SCA27B_FGF14 chr14 23321473 23321503 GCN OPMD_PABPN1 chr14 92071011 92071052 CTG SCA3_ATXN3 chr15 22786678 22786703 GCG ALS1_NIPA1 @@ -70,6 +70,6 @@ chrX 31284558 31284605 TTC DMD_DMD chrX 67545317 67545419 GCA SBMA_AR chrX 71453055 71453131 AGAGGG XDP_TAF1 chrX 137566827 137566856 GCN VACTERLX_ZIC3 -chrX 140504317 140504361 NGC XLMR_SOX3 +chrX 140504317 140504361 NGC XLID_SOX3 chrX 147912050 147912111 CGG FXS_FMR1 chrX 148500605 148500753 GCC FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.hg38.straglr.bed b/data/catalogs/STRchive-disease-loci.hg38.straglr.bed index 6b4a89c4..6dfa4fda 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.straglr.bed @@ -80,6 +80,6 @@ chrX 31284605 31284613 T DMD_DMD DMD_DMD_T chrX 67545316 67545419 GCA SBMA_AR SBMA_AR chrX 71453054 71453131 AGAGGG XDP_TAF1 XDP_TAF1 chrX 137566826 137566856 GCN VACTERLX_ZIC3 VACTERLX_ZIC3 -chrX 140504316 140504361 NGC XLMR_SOX3 XLMR_SOX3 +chrX 140504316 140504361 NGC XLID_SOX3 XLID_SOX3 chrX 147912049 147912111 CGG FXS_FMR1 FXS_FMR1 chrX 148500604 148500753 GCC FRAXE_AFF2 FRAXE_AFF2 diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json index 3231f70c..0db8e5d4 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg38.stranger.json @@ -393,7 +393,7 @@ "DisplayRU": "GGCCCC", "Disease": "FTDALS1", "NormalMax": 23, - "PathologicMin": 251, + "PathologicMin": 31, "Gene": "C9orf72" }, { @@ -961,14 +961,14 @@ "Gene": "ZIC3" }, { - "LocusId": "XLMR_SOX3", + "LocusId": "XLID_SOX3", "ReferenceRegion": "chrX:140504316-140504361", "LocusStructure": "(NGC)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["XR"], "DisplayRU": "NGC", - "Disease": "XLMR", + "Disease": "XLID, PHPX", "NormalMax": 15, "PathologicMin": 22, "Gene": "SOX3" diff --git a/data/plots/age-onset.json b/data/plots/age-onset.json index 5e202b61..5d565ed1 100644 --- a/data/plots/age-onset.json +++ b/data/plots/age-onset.json @@ -13,7 +13,7 @@ "orientation": "h", "width": 0.2, "x": [47.0, 32.0, 39.0, 52.0, 51.0, 44.0, 66.0, 71.0, 59.0, 0, 19.0, 46.0, 54.0, 57.0, 25.0, 56.0, 0, 53.0, 54.0, 72.0, 40.0, 23.0, 68.0, 40.0, 20.0, 75.0, 54.0, 60.0, 0, 61.0, 59.0, 57.0, 0, 0, 47.0, 56.0, 59.0, 10.0, 70.0, 84.0, 0, 0, 1.0, 84.0, 6.0, 0, 0, 73.0, 76.0, 72.0, 74.0, 0, 65.0, 0, 0, 3.0, 36.0, 0, 0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -29,7 +29,7 @@ "orientation": "h", "width": 0.2, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 57.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.0, 0, 0, 0, 0, 0, 0, 0, 78.0, 2.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10.0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -45,7 +45,7 @@ "orientation": "h", "width": 0.2, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -61,7 +61,7 @@ "orientation": "h", "width": 0.2, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 67.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 75.0, 0, 0, 0, 0, 1.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 9.0, 0, 0, 0, 0, 0, 9.0, 0, 4.0, 4.0, 0, 0, 0, 0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -78,7 +78,7 @@ "showlegend": false, "width": 0.6, "x": [19.0, 10.0, 20.0, 16.0, 0, 0, 28.0, 14.0, 19.0, 0, 0, 20.0, 0, 9.0, 0, 14.0, 0, 19.0, 22.0, 36.0, 0, 0, 40.0, 6.0, 12.0, 6.0, 24.0, 18.0, 0, 0, 20.0, 19.0, 0, 0, 0, 18.0, 29.0, 0, 39.0, 9.0, 0, 0, 0, 9.0, 0, 0, 0, 28.0, 29.0, 20.0, 20.0, 0, 44.0, 0, 0, 0, 2.0, 0, 0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -95,7 +95,7 @@ "showlegend": false, "width": 0.6, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 16.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 9.0, 0, 0, 0, 0, 0, 0, 0, 5.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2.0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -112,7 +112,7 @@ "showlegend": false, "width": 0.6, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 64.0, 0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -129,7 +129,7 @@ "showlegend": false, "width": 0.6, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 29.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 8.0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0], - "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -727,7 +727,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLMR", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "tickvals": ["FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "OPDM2", "XDP", "SCA4", "HDL2", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "title": { "text": "Disease" diff --git a/data/plots/path-size.json b/data/plots/path-size.json index 825f367b..de12fb14 100644 --- a/data/plots/path-size.json +++ b/data/plots/path-size.json @@ -1,7 +1,7 @@ { "data": [ { - "base": [0, 50, 18, 2871, 0, 0, 15, 1, 12, 0, 15, 252, 10, 24, 9, 18, 12, 15, 0, 0, 9, 24, 18, 9, 15, 44, 0, 20, 39, 1, 1, 45, 0, 21, 33, 48, 15, 1, 18, 30, 15, 75, 18, 42, 60, 18, 96, 18, 27, 12, 18, 42, 27, 45, 45, 42, 24, 45, 45, 12, 36, 12, 36, 21, 30, 42, 0, 30, 30, 18, 15, 16, 20, 30], + "base": [0, 50, 18, 2871, 0, 0, 15, 1, 0, 15, 252, 10, 24, 9, 18, 12, 15, 0, 0, 9, 24, 18, 9, 15, 44, 0, 20, 39, 1, 1, 45, 0, 21, 12, 33, 48, 15, 1, 18, 30, 15, 75, 18, 42, 60, 18, 96, 18, 27, 12, 18, 42, 27, 45, 45, 42, 24, 45, 45, 12, 36, 12, 36, 21, 30, 42, 0, 30, 30, 18, 15, 16, 20, 30], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Benign", "marker": @@ -12,12 +12,12 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 110, 66, 198, 0, 0, 99, 54, 126, 0, 51, 780, 25, 513, 51, 51, 105, 117, 0, 0, 39, 12, 30, 123, 222, 60, 0, 220, 96, 95, 59, 105, 0, 90, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 48, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FTDALS1", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLMR", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 110, 66, 198, 0, 0, 99, 54, 0, 51, 780, 25, 513, 51, 51, 105, 117, 0, 0, 39, 12, 30, 123, 222, 60, 0, 220, 96, 95, 59, 105, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 48, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { - "base": [0, 165, 90, 0, 0, 0, 0, 55, 144, 0, 126, 0, 0, 540, 0, 417, 120, 135, 0, 0, 0, 0, 0, 0, 240, 108, 0, 260, 0, 0, 0, 150, 0, 114, 135, 0, 102, 0, 120, 120, 105, 123, 108, 81, 0, 87, 0, 108, 108, 84, 81, 93, 63, 0, 0, 0, 0, 0, 0, 57, 0, 0, 0, 0, 0, 0, 0, 33, 33, 0, 0, 0, 0, 0], + "base": [0, 165, 90, 0, 0, 0, 0, 55, 0, 126, 0, 0, 540, 0, 417, 120, 135, 0, 0, 0, 0, 0, 0, 240, 108, 0, 260, 0, 0, 0, 150, 0, 114, 144, 135, 0, 102, 0, 120, 120, 105, 123, 108, 81, 0, 87, 0, 108, 108, 84, 81, 93, 63, 0, 0, 0, 0, 0, 0, 57, 0, 0, 0, 0, 0, 0, 0, 33, 33, 0, 0, 0, 0, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Intermediate", "marker": @@ -28,12 +28,12 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 4085, 3804, 0, 0, 0, 0, 945, 216, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 60, 0, 81, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 9, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FTDALS1", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLMR", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 4085, 3804, 0, 0, 0, 0, 945, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 60, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 9, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { - "base": [5000, 4000, 3900, 3663, 3300, 3250, 2040, 2000, 1506, 1370, 1350, 1260, 1000, 960, 900, 819, 603, 603, 550, 525, 483, 360, 360, 354, 303, 300, 300, 280, 255, 219, 216, 213, 210, 198, 180, 177, 168, 155, 153, 153, 150, 147, 144, 138, 135, 120, 120, 117, 114, 111, 108, 105, 78, 75, 75, 66, 66, 66, 66, 63, 60, 60, 54, 54, 51, 45, 45, 36, 36, 33, 18, 12, 10, 0], + "base": [5000, 4000, 3900, 3663, 3300, 3250, 2040, 2000, 1370, 1350, 1260, 1000, 960, 900, 819, 603, 603, 550, 525, 483, 360, 360, 354, 303, 300, 300, 280, 255, 219, 216, 213, 210, 198, 186, 180, 177, 168, 155, 153, 153, 150, 147, 144, 138, 135, 120, 120, 117, 114, 111, 108, 105, 78, 75, 75, 66, 66, 66, 66, 63, 60, 60, 54, 54, 51, 45, 45, 36, 36, 33, 18, 12, 10, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Pathogenic", "marker": @@ -44,8 +44,8 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 18500, 11100, 1287, 0, 1925, 2460, 11750, 23022, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 3250, 17875, 1617, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 273, 114, 3687, 102, 1353, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 20, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FTDALS1", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLMR", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 18500, 11100, 1287, 0, 1925, 2460, 11750, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 3250, 17875, 1617, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 273, 114, 3687, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 20, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { @@ -126,32 +126,6 @@ "y": ["CANVAS", "CANVAS"], "type": "scatter" }, - { - "hoverinfo": "skip", - "line": - { - "color": "#aeaeae", - "dash": "dot" - }, - "mode": "lines", - "showlegend": false, - "x": [138, 144], - "y": ["FTDALS1", "FTDALS1"], - "type": "scatter" - }, - { - "hoverinfo": "skip", - "line": - { - "color": "#aeaeae", - "dash": "dot" - }, - "mode": "lines", - "showlegend": false, - "x": [360, 1506], - "y": ["FTDALS1", "FTDALS1"], - "type": "scatter" - }, { "hoverinfo": "skip", "line": @@ -529,6 +503,32 @@ "y": ["NIID", "NIID"], "type": "scatter" }, + { + "hoverinfo": "skip", + "line": + { + "color": "#aeaeae", + "dash": "dot" + }, + "mode": "lines", + "showlegend": false, + "x": [138, 144], + "y": ["FTDALS1", "FTDALS1"], + "type": "scatter" + }, + { + "hoverinfo": "skip", + "line": + { + "color": "#aeaeae", + "dash": "dot" + }, + "mode": "lines", + "showlegend": false, + "x": [180, 186], + "y": ["FTDALS1", "FTDALS1"], + "type": "scatter" + }, { "hoverinfo": "skip", "line": @@ -1046,7 +1046,7 @@ "mode": "lines", "showlegend": false, "x": [45, 66], - "y": ["XLMR", "XLMR"], + "y": ["XLID, PHPX", "XLID, PHPX"], "type": "scatter" }, { @@ -1256,7 +1256,7 @@ "name": "Benign", "showlegend": false, "x": [96, 45, 45, 42, 45, 45, 36, 36, 42, 30, 30, 15, 16, 20, 30], - "y": ["CJD", "TOF", "HPE5", "HFG-I", "SD5", "XLMR", "PRTS", "HFG-II", "BPES", "OPMD", "VACTERLX", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "y": ["CJD", "TOF", "HPE5", "HFG-I", "SD5", "XLID, PHPX", "PRTS", "HFG-II", "BPES", "OPMD", "VACTERLX", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "scatter" }, { @@ -1869,7 +1869,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FTDALS1", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLMR", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "tickvals": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "SCA31", "FAME1", "OPML1", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "title": { "text": "Disease" diff --git a/data/ref-alleles/ref-alleles.T2T-chm13.txt b/data/ref-alleles/ref-alleles.T2T-chm13.txt index 1ce62e6a..8e9254b7 100644 --- a/data/ref-alleles/ref-alleles.T2T-chm13.txt +++ b/data/ref-alleles/ref-alleles.T2T-chm13.txt @@ -89,8 +89,8 @@ CAAGTCCTTC CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG C CAAGTCCTTC CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAA CAG CCG CCA CCG CCG CCG CCG CCG CCG CCG CCT CCTCAGCTTC CANVAS_RFC1 -chr4 39318077 39318136 AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG STRchive -chr4 39318077 39318136 AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG TRGT +chr4 39318077 39318136 AAAAG,AAGGG,ACAGG,AAAGG,AGGGC STRchive +chr4 39318077 39318136 AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG TRGT TCTGTTTCAA AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAA AGCATGTTCT TCTGTTTCAA AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAA AGCATGTTCT @@ -240,7 +240,7 @@ CCTGTCCCCA GCG GCG GCG GCA GCG GCG GCG GCG GCT GCG GCG GCG GCG GCC GCG G TGTCCGC SCA27B_FGF14 chr13 101377549 101377792 GAA STRchive -chr13 101377549 101377792 GAA,GAAGGA,GAAGAAGAAGAAGCA TRGT +chr13 101377549 101377792 GAA,GGA,GCA TRGT AACTTTCTGT GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA AAATGTGTTT AACTTTCTGT GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA AAATGTGTTT @@ -430,7 +430,7 @@ chrX 135876774 135876804 GCN TRGT CTCAACCCAC GCC GCC GCC GCC GCC GCC GCC GCC GCT GCC TTCAAGCTGA CTCAACCCAC GCC GCC GCC GCC GCC GCC GCC GCC GCT GCC TTCAAGCTGA -XLMR_SOX3 +XLID_SOX3 chrX 138816203 138816248 NGC STRchive chrX 138816203 138816248 NGC TRGT CCGGACTGCT GGC GGC AGC GGC TGC GGC CGC GGC AGC GGC GGC GGC GGC CGC GGC ACCGGGAGGC diff --git a/data/ref-alleles/ref-alleles.hg19.txt b/data/ref-alleles/ref-alleles.hg19.txt index 4571380e..b9ae4c34 100644 --- a/data/ref-alleles/ref-alleles.hg19.txt +++ b/data/ref-alleles/ref-alleles.hg19.txt @@ -89,8 +89,8 @@ CAAGTCCTTC CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG C CAAGTCCTTC CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAA CAG CCG CCA CCG CCG CCG CCG CCG CCG CCG CCT CCTCAGCTTC CANVAS_RFC1 -chr4 39350044 39350103 AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG STRchive -chr4 39350044 39350103 AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG TRGT +chr4 39350044 39350103 AAAAG,AAGGG,ACAGG,AAAGG,AGGGC STRchive +chr4 39350044 39350103 AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG TRGT TCTGTTTCAA AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAA AGCATGTTCT TCTGTTTCAA AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAA AGCATGTTCT @@ -240,7 +240,7 @@ CCTGTCCCCA GCG GCG GCG GCA GCG GCG GCG GCG GCT GCG GCG GCG GCG GCC GCG G TGTCCGC SCA27B_FGF14 chr13 102813924 102814076 GAA STRchive -chr13 102813924 102814076 GAA,GAAGGA,GAAGAAGAAGAAGCA TRGT +chr13 102813924 102814076 GAA,GGA,GCA TRGT TGAAGAAAGA AA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA TAGAAATGTG TGAAGAAAGA AA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA TAGAAATGTG @@ -430,7 +430,7 @@ chrX 136648985 136649015 GCN TRGT CTCAACCCAC GCC GCC GCC GCC GCC GCC GCC GCC GCT GCC TTCAAGCTGA CTCAACCCAC GCC GCC GCC GCC GCC GCC GCC GCC GCT GCC TTCAAGCTGA -XLMR_SOX3 +XLID_SOX3 chrX 139586481 139586526 NGC STRchive chrX 139586481 139586526 NGC TRGT CCGGACTGCT GGC GGC AGC GGC TGC GGC CGC GGC AGC GGC GGC GGC GGC CGC GGC ACCGGGAGGC diff --git a/data/ref-alleles/ref-alleles.hg38.txt b/data/ref-alleles/ref-alleles.hg38.txt index a7875038..67d9fac9 100644 --- a/data/ref-alleles/ref-alleles.hg38.txt +++ b/data/ref-alleles/ref-alleles.hg38.txt @@ -89,8 +89,8 @@ CAAGTCCTTC CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG C CAAGTCCTTC CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAA CAG CCG CCA CCG CCG CCG CCG CCG CCG CCG CCT CCTCAGCTTC CANVAS_RFC1 -chr4 39348424 39348483 AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG STRchive -chr4 39348424 39348483 AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG TRGT +chr4 39348424 39348483 AAAAG,AAGGG,ACAGG,AAAGG,AGGGC STRchive +chr4 39348424 39348483 AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG TRGT TCTGTTTCAA AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAA AGCATGTTCT TCTGTTTCAA AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAAG AAAA AGCATGTTCT @@ -240,7 +240,7 @@ CCTGTCCCCA GCG GCG GCG GCA GCG GCG GCG GCG GCT GCG GCG GCG GCG GCC GCG G TGTCCGC SCA27B_FGF14 chr13 102161574 102161726 GAA STRchive -chr13 102161574 102161726 GAA,GAAGGA,GAAGAAGAAGAAGCA TRGT +chr13 102161574 102161726 GAA,GGA,GCA TRGT TGAAGAAAGA AA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA TAGAAATGTG TGAAGAAAGA AA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA TAGAAATGTG @@ -430,7 +430,7 @@ chrX 137566826 137566856 GCN TRGT CTCAACCCAC GCC GCC GCC GCC GCC GCC GCC GCC GCT GCC TTCAAGCTGA CTCAACCCAC GCC GCC GCC GCC GCC GCC GCC GCC GCT GCC TTCAAGCTGA -XLMR_SOX3 +XLID_SOX3 chrX 140504316 140504361 NGC STRchive chrX 140504316 140504361 NGC TRGT CCGGACTGCT GGC GGC AGC GGC TGC GGC CGC GGC AGC GGC GGC GGC GGC CGC GGC ACCGGGAGGC