From aef770552ef305616e22566d398685690a19a070 Mon Sep 17 00:00:00 2001
From: Ehsan ESTAJI <71376358+ehsanestaji@users.noreply.github.com>
Date: Fri, 3 Jul 2026 21:56:48 +0200
Subject: [PATCH 1/5] add fastaguard module

---
 modules/nf-core/fastaguard/environment.yml    |   5 +
 modules/nf-core/fastaguard/main.nf            |  44 +++++++
 modules/nf-core/fastaguard/meta.yml           | 108 ++++++++++++++++++
 modules/nf-core/fastaguard/tests/data/fail.fa |   6 +
 .../nf-core/fastaguard/tests/data/invalid.fa  |   3 +
 modules/nf-core/fastaguard/tests/data/pass.fa |   2 +
 modules/nf-core/fastaguard/tests/data/warn.fa |   4 +
 modules/nf-core/fastaguard/tests/main.nf.test |  95 +++++++++++++++
 8 files changed, 267 insertions(+)
 create mode 100644 modules/nf-core/fastaguard/environment.yml
 create mode 100644 modules/nf-core/fastaguard/main.nf
 create mode 100644 modules/nf-core/fastaguard/meta.yml
 create mode 100644 modules/nf-core/fastaguard/tests/data/fail.fa
 create mode 100644 modules/nf-core/fastaguard/tests/data/invalid.fa
 create mode 100644 modules/nf-core/fastaguard/tests/data/pass.fa
 create mode 100644 modules/nf-core/fastaguard/tests/data/warn.fa
 create mode 100644 modules/nf-core/fastaguard/tests/main.nf.test

diff --git a/modules/nf-core/fastaguard/environment.yml b/modules/nf-core/fastaguard/environment.yml
new file mode 100644
index 000000000000..6786c8e608df
--- /dev/null
+++ b/modules/nf-core/fastaguard/environment.yml
@@ -0,0 +1,5 @@
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - bioconda::fastaguard=0.5.0
diff --git a/modules/nf-core/fastaguard/main.nf b/modules/nf-core/fastaguard/main.nf
new file mode 100644
index 000000000000..1c21b5c9b8dd
--- /dev/null
+++ b/modules/nf-core/fastaguard/main.nf
@@ -0,0 +1,44 @@
+process FASTAGUARD {
+    tag "$meta.id"
+    label 'process_low'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine in ['singularity', 'apptainer'] && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/fastaguard:0.5.0--hfa8f182_0':
+        'quay.io/biocontainers/fastaguard:0.5.0--hfa8f182_0' }"
+
+    input:
+    tuple val(meta), path(fasta)
+
+    output:
+    tuple val(meta), path("*.fastaguard.html"), emit: html
+    tuple val(meta), path("*.fastaguard.json"), emit: json
+    tuple val(meta), path("*.fastaguard.tsv"), emit: tsv
+    tuple val(meta), path("*.fastaguard_mqc.json"), emit: mqc
+    tuple val(meta), path("*.fastaguard.exit_code"), emit: exit_code
+    tuple val("${task.process}"), val('fastaguard'), eval('fastaguard --version | cut -d " " -f 2'), emit: versions_fastaguard, topic: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def prefix = task.ext.prefix ?: meta.id
+    def args = task.ext.args ?: '--profile assembly --gate pipeline'
+    """
+    set +e
+    fastaguard ${fasta} \
+      ${args} \
+      --out ${prefix}.fastaguard.html \
+      --json ${prefix}.fastaguard.json \
+      --tsv ${prefix}.fastaguard.tsv \
+      --multiqc ${prefix}.fastaguard_mqc.json
+    status=\$?
+    set -e
+
+    printf "%s\\n" "\${status}" > ${prefix}.fastaguard.exit_code
+
+    if [ "\${status}" -eq 3 ]; then
+      exit "\${status}"
+    fi
+    """
+}
diff --git a/modules/nf-core/fastaguard/meta.yml b/modules/nf-core/fastaguard/meta.yml
new file mode 100644
index 000000000000..734cc8c27e40
--- /dev/null
+++ b/modules/nf-core/fastaguard/meta.yml
@@ -0,0 +1,108 @@
+name: "fastaguard"
+description: FASTA preflight QC for assembly pipelines
+keywords:
+  - fasta
+  - assembly
+  - qc
+tools:
+  - "fastaguard":
+      description: FASTA preflight QC for assembly pipelines
+      homepage: "https://github.com/ehsanestaji/FastaGuard"
+      documentation: "https://github.com/ehsanestaji/FastaGuard"
+      tool_dev_url: "https://github.com/ehsanestaji/FastaGuard"
+      licence:
+        - "MIT"
+      identifier: ""
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'sample' ]
+    - fasta:
+        type: file
+        description: Assembly FASTA file
+        pattern: "*.{fa,fasta,fa.gz,fasta.gz}"
+        ontologies: []
+output:
+  html:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. [ id:'sample' ]
+      - "*.fastaguard.html":
+          type: file
+          description: FastaGuard HTML report
+          pattern: "*.fastaguard.html"
+          ontologies: []
+  json:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. [ id:'sample' ]
+      - "*.fastaguard.json":
+          type: file
+          description: FastaGuard JSON report
+          pattern: "*.fastaguard.json"
+          ontologies:
+            - edam: http://edamontology.org/format_3464
+  tsv:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. [ id:'sample' ]
+      - "*.fastaguard.tsv":
+          type: file
+          description: FastaGuard TSV summary
+          pattern: "*.fastaguard.tsv"
+          ontologies:
+            - edam: http://edamontology.org/format_3475
+  mqc:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. [ id:'sample' ]
+      - "*.fastaguard_mqc.json":
+          type: file
+          description: MultiQC custom-content JSON
+          pattern: "*.fastaguard_mqc.json"
+          ontologies:
+            - edam: http://edamontology.org/format_3464
+  exit_code:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. [ id:'sample' ]
+      - "*.fastaguard.exit_code":
+          type: file
+          description: FastaGuard CLI exit code for collect-then-gate workflows
+          pattern: "*.fastaguard.exit_code"
+          ontologies: []
+  versions_fastaguard:
+    - - ${task.process}:
+          type: string
+          description: The process the versions were collected from
+      - fastaguard:
+          type: string
+          description: The tool name
+      - fastaguard --version | cut -d " " -f 2:
+          type: eval
+          description: The expression to obtain the version of the tool
+topics:
+  versions:
+    - - ${task.process}:
+          type: string
+          description: The process the versions were collected from
+      - fastaguard:
+          type: string
+          description: The tool name
+      - fastaguard --version | cut -d " " -f 2:
+          type: eval
+          description: The expression to obtain the version of the tool
+authors:
+  - "FastaGuard contributors"
diff --git a/modules/nf-core/fastaguard/tests/data/fail.fa b/modules/nf-core/fastaguard/tests/data/fail.fa
new file mode 100644
index 000000000000..cea2c6b7fec8
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/data/fail.fa
@@ -0,0 +1,6 @@
+>dup
+ACGTACGT
+>dup
+ACGTACGT
+>bad
+ACGTXYZ
diff --git a/modules/nf-core/fastaguard/tests/data/invalid.fa b/modules/nf-core/fastaguard/tests/data/invalid.fa
new file mode 100644
index 000000000000..717a70dc4655
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/data/invalid.fa
@@ -0,0 +1,3 @@
+>empty_record
+>next_record
+ACGT
diff --git a/modules/nf-core/fastaguard/tests/data/pass.fa b/modules/nf-core/fastaguard/tests/data/pass.fa
new file mode 100644
index 000000000000..3d90f7cbe195
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/data/pass.fa
@@ -0,0 +1,2 @@
+>clean
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
diff --git a/modules/nf-core/fastaguard/tests/data/warn.fa b/modules/nf-core/fastaguard/tests/data/warn.fa
new file mode 100644
index 000000000000..564261615f3e
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/data/warn.fa
@@ -0,0 +1,4 @@
+>long
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
+>tiny
+ACGT
diff --git a/modules/nf-core/fastaguard/tests/main.nf.test b/modules/nf-core/fastaguard/tests/main.nf.test
new file mode 100644
index 000000000000..abc00aae9790
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/main.nf.test
@@ -0,0 +1,95 @@
+nextflow_process {
+
+    name "Test FASTAGUARD"
+    script "../main.nf"
+    process "FASTAGUARD"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "fastaguard"
+    tag "fastaguard_single"
+
+    test("pass FASTA emits all reports") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'pass' ],
+                    file("${moduleDir}/tests/data/pass.fa", checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assert process.success
+            assert file(process.out.html[0][1]).name.endsWith(".fastaguard.html")
+            assert file(process.out.json[0][1]).name.endsWith(".fastaguard.json")
+            assert file(process.out.tsv[0][1]).name.endsWith(".fastaguard.tsv")
+            assert file(process.out.mqc[0][1]).name.endsWith(".fastaguard_mqc.json")
+            assert file(process.out.exit_code[0][1]).name.endsWith(".fastaguard.exit_code")
+            assert file(process.out.exit_code[0][1]).text.trim() == "0"
+            assert process.out.versions_fastaguard
+        }
+    }
+
+    test("warn FASTA preserves reports") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'warn' ],
+                    file("${moduleDir}/tests/data/warn.fa", checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assert process.success
+            assert process.out.json
+            assert process.out.mqc
+            assert file(process.out.exit_code[0][1]).text.trim() == "1"
+        }
+    }
+
+    test("fail FASTA preserves reports for gate review") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'fail' ],
+                    file("${moduleDir}/tests/data/fail.fa", checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assert process.success
+            assert process.out.json
+            assert process.out.mqc
+            assert file(process.out.exit_code[0][1]).text.trim() == "2"
+        }
+    }
+
+    test("invalid FASTA is represented in the evidence path") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'invalid' ],
+                    file("${moduleDir}/tests/data/invalid.fa", checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assert process.success
+            assert process.out.json
+            assert process.out.mqc
+            assert file(process.out.exit_code[0][1]).text.trim() == "2"
+        }
+    }
+}

From a82020772466e84dd1ad7f31845996d7d1ceb2dc Mon Sep 17 00:00:00 2001
From: Ehsan ESTAJI <71376358+ehsanestaji@users.noreply.github.com>
Date: Sun, 5 Jul 2026 21:55:39 +0200
Subject: [PATCH 2/5] test: inline fastaguard fixtures

---
 modules/nf-core/fastaguard/tests/data/fail.fa |   6 -
 .../nf-core/fastaguard/tests/data/invalid.fa  |   3 -
 modules/nf-core/fastaguard/tests/data/pass.fa |   2 -
 modules/nf-core/fastaguard/tests/data/warn.fa |   4 -
 modules/nf-core/fastaguard/tests/main.nf.test |  79 ++++--
 .../fastaguard/tests/main.nf.test.snap        | 234 ++++++++++++++++++
 6 files changed, 289 insertions(+), 39 deletions(-)
 delete mode 100644 modules/nf-core/fastaguard/tests/data/fail.fa
 delete mode 100644 modules/nf-core/fastaguard/tests/data/invalid.fa
 delete mode 100644 modules/nf-core/fastaguard/tests/data/pass.fa
 delete mode 100644 modules/nf-core/fastaguard/tests/data/warn.fa
 create mode 100644 modules/nf-core/fastaguard/tests/main.nf.test.snap

diff --git a/modules/nf-core/fastaguard/tests/data/fail.fa b/modules/nf-core/fastaguard/tests/data/fail.fa
deleted file mode 100644
index cea2c6b7fec8..000000000000
--- a/modules/nf-core/fastaguard/tests/data/fail.fa
+++ /dev/null
@@ -1,6 +0,0 @@
->dup
-ACGTACGT
->dup
-ACGTACGT
->bad
-ACGTXYZ
diff --git a/modules/nf-core/fastaguard/tests/data/invalid.fa b/modules/nf-core/fastaguard/tests/data/invalid.fa
deleted file mode 100644
index 717a70dc4655..000000000000
--- a/modules/nf-core/fastaguard/tests/data/invalid.fa
+++ /dev/null
@@ -1,3 +0,0 @@
->empty_record
->next_record
-ACGT
diff --git a/modules/nf-core/fastaguard/tests/data/pass.fa b/modules/nf-core/fastaguard/tests/data/pass.fa
deleted file mode 100644
index 3d90f7cbe195..000000000000
--- a/modules/nf-core/fastaguard/tests/data/pass.fa
+++ /dev/null
@@ -1,2 +0,0 @@
->clean
-ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
diff --git a/modules/nf-core/fastaguard/tests/data/warn.fa b/modules/nf-core/fastaguard/tests/data/warn.fa
deleted file mode 100644
index 564261615f3e..000000000000
--- a/modules/nf-core/fastaguard/tests/data/warn.fa
+++ /dev/null
@@ -1,4 +0,0 @@
->long
-ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
->tiny
-ACGT
diff --git a/modules/nf-core/fastaguard/tests/main.nf.test b/modules/nf-core/fastaguard/tests/main.nf.test
index abc00aae9790..0586408cb965 100644
--- a/modules/nf-core/fastaguard/tests/main.nf.test
+++ b/modules/nf-core/fastaguard/tests/main.nf.test
@@ -13,23 +13,26 @@ nextflow_process {
         when {
             process {
                 """
+                def fasta = file(workDir.resolve("pass.fa").toString())
+                fasta.text = [
+                    ">clean",
+                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"
+                ].join("\\n") + "\\n"
+
                 input[0] = [
                     [ id:'pass' ],
-                    file("${moduleDir}/tests/data/pass.fa", checkIfExists: true)
+                    fasta
                 ]
                 """
             }
         }
 
         then {
-            assert process.success
-            assert file(process.out.html[0][1]).name.endsWith(".fastaguard.html")
-            assert file(process.out.json[0][1]).name.endsWith(".fastaguard.json")
-            assert file(process.out.tsv[0][1]).name.endsWith(".fastaguard.tsv")
-            assert file(process.out.mqc[0][1]).name.endsWith(".fastaguard_mqc.json")
-            assert file(process.out.exit_code[0][1]).name.endsWith(".fastaguard.exit_code")
-            assert file(process.out.exit_code[0][1]).text.trim() == "0"
-            assert process.out.versions_fastaguard
+            assertAll(
+                { assert process.success },
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
+                { assert file(process.out.exit_code[0][1]).text.trim() == "0" }
+            )
         }
     }
 
@@ -37,19 +40,28 @@ nextflow_process {
         when {
             process {
                 """
+                def fasta = file(workDir.resolve("warn.fa").toString())
+                fasta.text = [
+                    ">long",
+                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+                    ">tiny",
+                    "ACGT"
+                ].join("\\n") + "\\n"
+
                 input[0] = [
                     [ id:'warn' ],
-                    file("${moduleDir}/tests/data/warn.fa", checkIfExists: true)
+                    fasta
                 ]
                 """
             }
         }
 
         then {
-            assert process.success
-            assert process.out.json
-            assert process.out.mqc
-            assert file(process.out.exit_code[0][1]).text.trim() == "1"
+            assertAll(
+                { assert process.success },
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
+                { assert file(process.out.exit_code[0][1]).text.trim() == "1" }
+            )
         }
     }
 
@@ -57,19 +69,30 @@ nextflow_process {
         when {
             process {
                 """
+                def fasta = file(workDir.resolve("fail.fa").toString())
+                fasta.text = [
+                    ">dup",
+                    "ACGTACGT",
+                    ">dup",
+                    "ACGTACGT",
+                    ">bad",
+                    "ACGTXYZ"
+                ].join("\\n") + "\\n"
+
                 input[0] = [
                     [ id:'fail' ],
-                    file("${moduleDir}/tests/data/fail.fa", checkIfExists: true)
+                    fasta
                 ]
                 """
             }
         }
 
         then {
-            assert process.success
-            assert process.out.json
-            assert process.out.mqc
-            assert file(process.out.exit_code[0][1]).text.trim() == "2"
+            assertAll(
+                { assert process.success },
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
+                { assert file(process.out.exit_code[0][1]).text.trim() == "2" }
+            )
         }
     }
 
@@ -77,19 +100,27 @@ nextflow_process {
         when {
             process {
                 """
+                def fasta = file(workDir.resolve("invalid.fa").toString())
+                fasta.text = [
+                    ">empty_record",
+                    ">next_record",
+                    "ACGT"
+                ].join("\\n") + "\\n"
+
                 input[0] = [
                     [ id:'invalid' ],
-                    file("${moduleDir}/tests/data/invalid.fa", checkIfExists: true)
+                    fasta
                 ]
                 """
             }
         }
 
         then {
-            assert process.success
-            assert process.out.json
-            assert process.out.mqc
-            assert file(process.out.exit_code[0][1]).text.trim() == "2"
+            assertAll(
+                { assert process.success },
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
+                { assert file(process.out.exit_code[0][1]).text.trim() == "2" }
+            )
         }
     }
 }
diff --git a/modules/nf-core/fastaguard/tests/main.nf.test.snap b/modules/nf-core/fastaguard/tests/main.nf.test.snap
new file mode 100644
index 000000000000..61e82ef702ce
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/main.nf.test.snap
@@ -0,0 +1,234 @@
+{
+    "invalid FASTA is represented in the evidence path": {
+        "content": [
+            {
+                "exit_code": [
+                    [
+                        {
+                            "id": "invalid"
+                        },
+                        "invalid.fastaguard.exit_code:md5,26ab0db90d72e28ad0ba1e22ee510510"
+                    ]
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "invalid"
+                        },
+                        "invalid.fastaguard.html"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "invalid"
+                        },
+                        "invalid.fastaguard.json"
+                    ]
+                ],
+                "mqc": [
+                    [
+                        {
+                            "id": "invalid"
+                        },
+                        "invalid.fastaguard_mqc.json"
+                    ]
+                ],
+                "tsv": [
+                    [
+                        {
+                            "id": "invalid"
+                        },
+                        "invalid.fastaguard.tsv"
+                    ]
+                ],
+                "versions_fastaguard": [
+                    [
+                        "FASTAGUARD",
+                        "fastaguard",
+                        "0.5.0"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-07-05T21:53:00.621129",
+        "meta": {
+            "nf-test": "0.9.5",
+            "nextflow": "26.04.4"
+        }
+    },
+    "fail FASTA preserves reports for gate review": {
+        "content": [
+            {
+                "exit_code": [
+                    [
+                        {
+                            "id": "fail"
+                        },
+                        "fail.fastaguard.exit_code:md5,26ab0db90d72e28ad0ba1e22ee510510"
+                    ]
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "fail"
+                        },
+                        "fail.fastaguard.html"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "fail"
+                        },
+                        "fail.fastaguard.json"
+                    ]
+                ],
+                "mqc": [
+                    [
+                        {
+                            "id": "fail"
+                        },
+                        "fail.fastaguard_mqc.json"
+                    ]
+                ],
+                "tsv": [
+                    [
+                        {
+                            "id": "fail"
+                        },
+                        "fail.fastaguard.tsv"
+                    ]
+                ],
+                "versions_fastaguard": [
+                    [
+                        "FASTAGUARD",
+                        "fastaguard",
+                        "0.5.0"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-07-05T21:52:53.226297",
+        "meta": {
+            "nf-test": "0.9.5",
+            "nextflow": "26.04.4"
+        }
+    },
+    "warn FASTA preserves reports": {
+        "content": [
+            {
+                "exit_code": [
+                    [
+                        {
+                            "id": "warn"
+                        },
+                        "warn.fastaguard.exit_code:md5,b026324c6904b2a9cb4b88d6d61c81d1"
+                    ]
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "warn"
+                        },
+                        "warn.fastaguard.html"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "warn"
+                        },
+                        "warn.fastaguard.json"
+                    ]
+                ],
+                "mqc": [
+                    [
+                        {
+                            "id": "warn"
+                        },
+                        "warn.fastaguard_mqc.json"
+                    ]
+                ],
+                "tsv": [
+                    [
+                        {
+                            "id": "warn"
+                        },
+                        "warn.fastaguard.tsv"
+                    ]
+                ],
+                "versions_fastaguard": [
+                    [
+                        "FASTAGUARD",
+                        "fastaguard",
+                        "0.5.0"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-07-05T21:52:45.428014",
+        "meta": {
+            "nf-test": "0.9.5",
+            "nextflow": "26.04.4"
+        }
+    },
+    "pass FASTA emits all reports": {
+        "content": [
+            {
+                "exit_code": [
+                    [
+                        {
+                            "id": "pass"
+                        },
+                        "pass.fastaguard.exit_code:md5,897316929176464ebc9ad085f31e7284"
+                    ]
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "pass"
+                        },
+                        "pass.fastaguard.html"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "pass"
+                        },
+                        "pass.fastaguard.json"
+                    ]
+                ],
+                "mqc": [
+                    [
+                        {
+                            "id": "pass"
+                        },
+                        "pass.fastaguard_mqc.json"
+                    ]
+                ],
+                "tsv": [
+                    [
+                        {
+                            "id": "pass"
+                        },
+                        "pass.fastaguard.tsv"
+                    ]
+                ],
+                "versions_fastaguard": [
+                    [
+                        "FASTAGUARD",
+                        "fastaguard",
+                        "0.5.0"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-07-05T21:52:37.489392",
+        "meta": {
+            "nf-test": "0.9.5",
+            "nextflow": "26.04.4"
+        }
+    }
+}
\ No newline at end of file

From 548f431661b80bbed7d34597956456af28b45992 Mon Sep 17 00:00:00 2001
From: Ehsan ESTAJI <71376358+ehsanestaji@users.noreply.github.com>
Date: Mon, 6 Jul 2026 18:02:56 +0200
Subject: [PATCH 3/5] test: shorten fastaguard fixtures

---
 modules/nf-core/fastaguard/tests/main.nf.test | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/modules/nf-core/fastaguard/tests/main.nf.test b/modules/nf-core/fastaguard/tests/main.nf.test
index 0586408cb965..7fb168046005 100644
--- a/modules/nf-core/fastaguard/tests/main.nf.test
+++ b/modules/nf-core/fastaguard/tests/main.nf.test
@@ -16,7 +16,7 @@ nextflow_process {
                 def fasta = file(workDir.resolve("pass.fa").toString())
                 fasta.text = [
                     ">clean",
-                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"
+                    ("ACGT" * 60)
                 ].join("\\n") + "\\n"
 
                 input[0] = [
@@ -43,7 +43,7 @@ nextflow_process {
                 def fasta = file(workDir.resolve("warn.fa").toString())
                 fasta.text = [
                     ">long",
-                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+                    ("ACGT" * 60),
                     ">tiny",
                     "ACGT"
                 ].join("\\n") + "\\n"

From 88f93dc12b1003c8718948b60f0e0cc42c7d27ab Mon Sep 17 00:00:00 2001
From: Ehsan ESTAJI <71376358+ehsanestaji@users.noreply.github.com>
Date: Mon, 6 Jul 2026 20:09:50 +0200
Subject: [PATCH 4/5] fix: align fastaguard module conventions

---
 modules/nf-core/fastaguard/main.nf               | 12 +++++-------
 modules/nf-core/fastaguard/meta.yml              |  2 +-
 modules/nf-core/fastaguard/tests/main.nf.test    |  1 +
 modules/nf-core/fastaguard/tests/nextflow.config |  5 +++++
 4 files changed, 12 insertions(+), 8 deletions(-)
 create mode 100644 modules/nf-core/fastaguard/tests/nextflow.config

diff --git a/modules/nf-core/fastaguard/main.nf b/modules/nf-core/fastaguard/main.nf
index 1c21b5c9b8dd..d61c870f6de1 100644
--- a/modules/nf-core/fastaguard/main.nf
+++ b/modules/nf-core/fastaguard/main.nf
@@ -22,22 +22,20 @@ process FASTAGUARD {
     task.ext.when == null || task.ext.when
 
     script:
-    def prefix = task.ext.prefix ?: meta.id
-    def args = task.ext.args ?: '--profile assembly --gate pipeline'
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def args = task.ext.args ?: ''
     """
-    set +e
+    status=0
     fastaguard ${fasta} \
       ${args} \
       --out ${prefix}.fastaguard.html \
       --json ${prefix}.fastaguard.json \
       --tsv ${prefix}.fastaguard.tsv \
-      --multiqc ${prefix}.fastaguard_mqc.json
-    status=\$?
-    set -e
+      --multiqc ${prefix}.fastaguard_mqc.json || status=\$?
 
     printf "%s\\n" "\${status}" > ${prefix}.fastaguard.exit_code
 
-    if [ "\${status}" -eq 3 ]; then
+    if [ "\${status}" -ge 3 ]; then
       exit "\${status}"
     fi
     """
diff --git a/modules/nf-core/fastaguard/meta.yml b/modules/nf-core/fastaguard/meta.yml
index 734cc8c27e40..d7707ca28ee0 100644
--- a/modules/nf-core/fastaguard/meta.yml
+++ b/modules/nf-core/fastaguard/meta.yml
@@ -105,4 +105,4 @@ topics:
           type: eval
           description: The expression to obtain the version of the tool
 authors:
-  - "FastaGuard contributors"
+  - "@ehsanestaji"
diff --git a/modules/nf-core/fastaguard/tests/main.nf.test b/modules/nf-core/fastaguard/tests/main.nf.test
index 7fb168046005..fd42239db3f5 100644
--- a/modules/nf-core/fastaguard/tests/main.nf.test
+++ b/modules/nf-core/fastaguard/tests/main.nf.test
@@ -3,6 +3,7 @@ nextflow_process {
     name "Test FASTAGUARD"
     script "../main.nf"
     process "FASTAGUARD"
+    config "./nextflow.config"
 
     tag "modules"
     tag "modules_nfcore"
diff --git a/modules/nf-core/fastaguard/tests/nextflow.config b/modules/nf-core/fastaguard/tests/nextflow.config
new file mode 100644
index 000000000000..245733682dcc
--- /dev/null
+++ b/modules/nf-core/fastaguard/tests/nextflow.config
@@ -0,0 +1,5 @@
+process {
+    withName: 'FASTAGUARD' {
+        ext.args = '--profile assembly --gate pipeline'
+    }
+}

From 11cca40a52f43197c3c0791b997a26c0630c282d Mon Sep 17 00:00:00 2001
From: Ehsan ESTAJI <71376358+ehsanestaji@users.noreply.github.com>
Date: Thu, 23 Jul 2026 12:54:15 +0200
Subject: [PATCH 5/5] fix: update fastaguard module for 0.6.0

---
 modules/nf-core/fastaguard/environment.yml    |  2 +-
 modules/nf-core/fastaguard/main.nf            | 14 +----
 modules/nf-core/fastaguard/meta.yml           | 11 ----
 modules/nf-core/fastaguard/tests/main.nf.test | 12 ++--
 .../fastaguard/tests/main.nf.test.snap        | 56 ++++---------------
 5 files changed, 20 insertions(+), 75 deletions(-)

diff --git a/modules/nf-core/fastaguard/environment.yml b/modules/nf-core/fastaguard/environment.yml
index 6786c8e608df..0448a46b6d29 100644
--- a/modules/nf-core/fastaguard/environment.yml
+++ b/modules/nf-core/fastaguard/environment.yml
@@ -2,4 +2,4 @@ channels:
   - conda-forge
   - bioconda
 dependencies:
-  - bioconda::fastaguard=0.5.0
+  - bioconda::fastaguard=0.6.0
diff --git a/modules/nf-core/fastaguard/main.nf b/modules/nf-core/fastaguard/main.nf
index d61c870f6de1..27e1d4b8eb45 100644
--- a/modules/nf-core/fastaguard/main.nf
+++ b/modules/nf-core/fastaguard/main.nf
@@ -4,8 +4,8 @@ process FASTAGUARD {
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine in ['singularity', 'apptainer'] && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/fastaguard:0.5.0--hfa8f182_0':
-        'quay.io/biocontainers/fastaguard:0.5.0--hfa8f182_0' }"
+        'https://depot.galaxyproject.org/singularity/fastaguard:0.6.0--hfa8f182_0':
+        'quay.io/biocontainers/fastaguard:0.6.0--hfa8f182_0' }"
 
     input:
     tuple val(meta), path(fasta)
@@ -15,7 +15,6 @@ process FASTAGUARD {
     tuple val(meta), path("*.fastaguard.json"), emit: json
     tuple val(meta), path("*.fastaguard.tsv"), emit: tsv
     tuple val(meta), path("*.fastaguard_mqc.json"), emit: mqc
-    tuple val(meta), path("*.fastaguard.exit_code"), emit: exit_code
     tuple val("${task.process}"), val('fastaguard'), eval('fastaguard --version | cut -d " " -f 2'), emit: versions_fastaguard, topic: versions
 
     when:
@@ -25,18 +24,11 @@ process FASTAGUARD {
     def prefix = task.ext.prefix ?: "${meta.id}"
     def args = task.ext.args ?: ''
     """
-    status=0
     fastaguard ${fasta} \
       ${args} \
       --out ${prefix}.fastaguard.html \
       --json ${prefix}.fastaguard.json \
       --tsv ${prefix}.fastaguard.tsv \
-      --multiqc ${prefix}.fastaguard_mqc.json || status=\$?
-
-    printf "%s\\n" "\${status}" > ${prefix}.fastaguard.exit_code
-
-    if [ "\${status}" -ge 3 ]; then
-      exit "\${status}"
-    fi
+      --multiqc ${prefix}.fastaguard_mqc.json
     """
 }
diff --git a/modules/nf-core/fastaguard/meta.yml b/modules/nf-core/fastaguard/meta.yml
index d7707ca28ee0..f54895873ff9 100644
--- a/modules/nf-core/fastaguard/meta.yml
+++ b/modules/nf-core/fastaguard/meta.yml
@@ -72,17 +72,6 @@ output:
           pattern: "*.fastaguard_mqc.json"
           ontologies:
             - edam: http://edamontology.org/format_3464
-  exit_code:
-    - - meta:
-          type: map
-          description: |
-            Groovy Map containing sample information
-            e.g. [ id:'sample' ]
-      - "*.fastaguard.exit_code":
-          type: file
-          description: FastaGuard CLI exit code for collect-then-gate workflows
-          pattern: "*.fastaguard.exit_code"
-          ontologies: []
   versions_fastaguard:
     - - ${task.process}:
           type: string
diff --git a/modules/nf-core/fastaguard/tests/main.nf.test b/modules/nf-core/fastaguard/tests/main.nf.test
index fd42239db3f5..24304bd0d08d 100644
--- a/modules/nf-core/fastaguard/tests/main.nf.test
+++ b/modules/nf-core/fastaguard/tests/main.nf.test
@@ -31,8 +31,7 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
-                { assert file(process.out.exit_code[0][1]).text.trim() == "0" }
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() }
             )
         }
     }
@@ -60,8 +59,7 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
-                { assert file(process.out.exit_code[0][1]).text.trim() == "1" }
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() }
             )
         }
     }
@@ -91,8 +89,7 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
-                { assert file(process.out.exit_code[0][1]).text.trim() == "2" }
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() }
             )
         }
     }
@@ -119,8 +116,7 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() },
-                { assert file(process.out.exit_code[0][1]).text.trim() == "2" }
+                { assert snapshot(sanitizeOutput(process.out, unstableKeys: ["html", "json", "tsv", "mqc"])).match() }
             )
         }
     }
diff --git a/modules/nf-core/fastaguard/tests/main.nf.test.snap b/modules/nf-core/fastaguard/tests/main.nf.test.snap
index 61e82ef702ce..d702507ca36a 100644
--- a/modules/nf-core/fastaguard/tests/main.nf.test.snap
+++ b/modules/nf-core/fastaguard/tests/main.nf.test.snap
@@ -2,14 +2,6 @@
     "invalid FASTA is represented in the evidence path": {
         "content": [
             {
-                "exit_code": [
-                    [
-                        {
-                            "id": "invalid"
-                        },
-                        "invalid.fastaguard.exit_code:md5,26ab0db90d72e28ad0ba1e22ee510510"
-                    ]
-                ],
                 "html": [
                     [
                         {
@@ -46,28 +38,20 @@
                     [
                         "FASTAGUARD",
                         "fastaguard",
-                        "0.5.0"
+                        "0.6.0"
                     ]
                 ]
             }
         ],
-        "timestamp": "2026-07-05T21:53:00.621129",
+        "timestamp": "2026-07-23T12:35:19.837744",
         "meta": {
             "nf-test": "0.9.5",
-            "nextflow": "26.04.4"
+            "nextflow": "25.04.6"
         }
     },
     "fail FASTA preserves reports for gate review": {
         "content": [
             {
-                "exit_code": [
-                    [
-                        {
-                            "id": "fail"
-                        },
-                        "fail.fastaguard.exit_code:md5,26ab0db90d72e28ad0ba1e22ee510510"
-                    ]
-                ],
                 "html": [
                     [
                         {
@@ -104,28 +88,20 @@
                     [
                         "FASTAGUARD",
                         "fastaguard",
-                        "0.5.0"
+                        "0.6.0"
                     ]
                 ]
             }
         ],
-        "timestamp": "2026-07-05T21:52:53.226297",
+        "timestamp": "2026-07-23T12:34:59.917502",
         "meta": {
             "nf-test": "0.9.5",
-            "nextflow": "26.04.4"
+            "nextflow": "25.04.6"
         }
     },
     "warn FASTA preserves reports": {
         "content": [
             {
-                "exit_code": [
-                    [
-                        {
-                            "id": "warn"
-                        },
-                        "warn.fastaguard.exit_code:md5,b026324c6904b2a9cb4b88d6d61c81d1"
-                    ]
-                ],
                 "html": [
                     [
                         {
@@ -162,28 +138,20 @@
                     [
                         "FASTAGUARD",
                         "fastaguard",
-                        "0.5.0"
+                        "0.6.0"
                     ]
                 ]
             }
         ],
-        "timestamp": "2026-07-05T21:52:45.428014",
+        "timestamp": "2026-07-23T12:34:47.135258",
         "meta": {
             "nf-test": "0.9.5",
-            "nextflow": "26.04.4"
+            "nextflow": "25.04.6"
         }
     },
     "pass FASTA emits all reports": {
         "content": [
             {
-                "exit_code": [
-                    [
-                        {
-                            "id": "pass"
-                        },
-                        "pass.fastaguard.exit_code:md5,897316929176464ebc9ad085f31e7284"
-                    ]
-                ],
                 "html": [
                     [
                         {
@@ -220,15 +188,15 @@
                     [
                         "FASTAGUARD",
                         "fastaguard",
-                        "0.5.0"
+                        "0.6.0"
                     ]
                 ]
             }
         ],
-        "timestamp": "2026-07-05T21:52:37.489392",
+        "timestamp": "2026-07-23T12:34:36.226584",
         "meta": {
             "nf-test": "0.9.5",
-            "nextflow": "26.04.4"
+            "nextflow": "25.04.6"
         }
     }
 }
\ No newline at end of file