Skip to content
Merged
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
228 changes: 228 additions & 0 deletions cookbook/03-blast.md
Original file line number Diff line number Diff line change
@@ -0,0 +1,228 @@
+++
using Dates
date = Date("2026-03-15")
title = "BLAST"
rss_descr = "Using NCBIBlast.jl to run BLAST searches"
+++

# Introduction to BLAST
A BLAST search allows you to query a sequence (either nucleotide or protein) against an entire database of sequences.
It can quickly compare unknown sequences to databases of established reference sequences for purposes such as species identity or assignment gene function.

More information about how to use BLAST can be found in its [manual](https://www.ncbi.nlm.nih.gov/books/NBK569856/).

BLAST searches can be run from the command line interface (CLI) or through the BLAST web page [here](https://blast.ncbi.nlm.nih.gov/Blast.cgi).
A user can simply copy in a protein or nucleotide sequence and search against NCBI to find the best match!
While searching from the website is fast and straightforward,
running searches from the website only performs searches against the NCBI databases.
The CLI allows users to query both NCBI databases and custom databases.

`NCBIBlast.jl` is a thin wrapper around the BLAST command line tool,
allowing users to run the tool within Julia.
The following BLAST tools are supported by `NCBIBlast`:
- `blastn`
- `blastp`
- `tblastn`
- `blastx`
- `makeblastdb`
Comment on lines +20 to +27
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

It might be nice to add to this section that a benefit of using the package is that it uses Julia's powerful BinaryBuilder.jl architechture to bundle the BLAST+ executables so that you don't have to deal with that. In other words, if you do add NCBIBLAST, you don't need to have the command line tools available.

Copy link
Copy Markdown
Collaborator Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I'll definitely add that! That is a huge plus!


A benefit of using the package is that it uses Julia's powerful `BinaryBuilder.jl` architechture to bundle the `BLAST+` executables
so that you don't have to deal with that.
In other words, if you do add `NCBIBLAST.jl`,
you don't need to have the command line tools available.

Note: [BioTools BLAST](https://biojulia.dev/BioTools.jl/stable/blast/) is a deprecated Julia package for running BLAST searches and is different from `NCBIBLAST`.




# How `NCBIBlast.jl` works


The keywords used in the tool are sent to the shell for running BLAST.

As stated on the GitHub [docs](https://github.com/BioJulia/NCBIBlast.jl), the Julia call

```
blastn(; query = "a_file.txt", db="mydb", out="results.txt")
```

is sent to the shell as

```
$ blastn -query a_file.txt -db mydb -out results.txt
```

# BLAST databases
Just like running a BLAST search from the CLI, `NCBIBlast.jl` requires a BLAST database to search against.
The user can build a local, custom database,
or search against a specific NCBI database.
A custom BLAST database is constructed from FASTA files that serve as reference sequences.
A database can be built using the following command in `NCBIBlast.jl`:
```
makeblastdb(; in="test/example_files/dna2.fasta", dbtype="nucl")
```

More directions on building a BLAST database locally can be found [here](https://www.ncbi.nlm.nih.gov/books/NBK569841/).


## Example: Building a local BLAST database and running the BLAST search

For our first example, we will replicate the example on the `NCBIBlast.jl` GitHub repository.

First, we will build a local database using a FASTA file found in the NCBIBlast github repository ([link here](https://github.com/BioJulia/NCBIBlast.jl/blob/main/test/example_files/dna2.fasta)).
This file has been downloaded into `assets` as `dna2.fasta`.

```
makeblastdb(; in="assets/dna2.fasta", dbtype="nucl")

Building a new DB, current time: 03/16/2026 21:04:36
New DB name: /LOCAL/PATH/BioTutorials/cookbook/assets/dna2.fasta
New DB title: assets/dna2.fasta
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 3000000000B
Adding sequences from FASTA; added 2 sequences in 0.0012269 seconds.


Process(`/Users/USER/.julia/artifacts/0406b91031ce302fa9117606d007d04635279fef/ncbi-blast-2.16.0+/bin/makeblastdb -in assets/dna2.fasta -dbtype nucl`, ProcessExited(0))
```
A new database was built in `assets`.

Now, we can define our query sequence.
We can save the query string in memory (using `IOBuffer`) rather than reading in a FASTA file.

```
buf = IOBuffer("TTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAG")
```

Now, we can run the BLAST search.
The BLAST output format "6" means that the output will be tab-delimited text with no column names.

The BLAST output will be written into I/O.
```
io = IOBuffer();
blastn(buf; stdout=io, db="assets/dna2.fasta", outfmt="6");
seek(io, 0);
```
The command `seek(io,0)` moves the cursor to the start of the captured object (index 0)
so it can be read into a dataframe via the [`DataFrames.jl`](https://dataframes.juliadata.org/stable/) package.

```
using CSV, DataFrames
CSV.read(io, DataFrame; header=false)

1×12 DataFrame
Row │ Column1 Column2 Column3 Column4 Column5 Column6 Column7 Column8 Column9 Column10 Column11 Column12
│ String7 String7 Float64 Int64 Int64 Int64 Int64 Int64 Int64 Int64 Float64 Float64
─────┼───────────────────────────────────────────────────────────────────────────────────────────────────────────────
1 │ Query_1 Test1 100.0 38 0 0 1 38 82 119 5.64e-18 71.3
```

### Interpreting BLAST Output
This output tells us that the query sequence
(`Query_1` is the default name for the sequence because we didn't specify a name)
matches `Test1` in the reference database.
There is 100% identity between the query and a region on `Test1` that is 38 nucleotides long.
There are 0 mismatches or gap openings.
The match starts at index 1 on the query sequence, and ends at index 82.
This region matches a region in the `Test1` sequence spanning from index 82 to 119.
The E-value is `5.64e-18`, meaning that it is extremely unlikely that this match occurred simply due to chance.

Here is a description of the E-value from the NCBI [website](https://blast.ncbi.nlm.nih.gov/doc/blast-help/FAQ.html):
> The Expect value (E) is a parameter that describes the number of hits one can “expect” to see
> by chance when searching a database of a particular size.
> It decreases exponentially as the Score (S) of the match increases.
> The lower the E-value the more “significant” the match is.
> However keep in mind that virtually identical short alignments have relatively high E values.
> This is because the calculation of the E value takes into account the length of the query sequence.
> These high E values make sense because shorter sequences
> have a higher probability of occurring in the database purely by chance.



The bitscore is 71.3.

Here is a definition of bitscore from the NCBI BLAST [glossary](https://www.ncbi.nlm.nih.gov/books/NBK62051/):
> The bit score, S',
> is derived from the raw alignment score, S,
> taking the statistical properties of the scoring system into account.
> Because bit scores are normalized with respect to the scoring system,
> they can be used to compare alignment scores from different searches.


## Example: BLASTing the _mecA1_ gene against all of NCBI
Now that we've tried BLAST'ing against a local, custom database,
let's try BLAST'ing a piece of the _mecA_ gene against NCBI.
To create the query file `mecA_BLAST.fasta`,
I randomly selected 140 nucleotides from `mecA.fasta`.

We should see that the query FASTA is a direct hit to the _mecA_ gene
(one of the NCBI hits should definitely be the NCBI sample `NG_047945.1`,
which is the sample the gene fragment was extracted from).

For this BLAST search, I will search against the `core_nt` database,
which is a faster, smaller, and more focused subset of the traditional `nt` (nucleotide) database.
This newer database is the default as of August 2024.
It seeks to reduce redundancy and storage requirements when downloading.
More information about it can be found [here](https://ncbiinsights.ncbi.nlm.nih.gov/2024/07/18/new-blast-core-nucleotide-database/).

General information about the different kinds of BLAST databases is also available [here](https://www.nlm.nih.gov/ncbi/workshops/2023-08_BLAST_evol/databases.html).

```
io = IOBuffer();
blastn("assets/mecA_BLAST.fasta"; db="core_nt", stdout=io, remote=true, outfmt="6 query subject expect")
seek(io, 0);
CSV.read(io, DataFrame; header=false)
```

Here is the output of the BLAST.

```
julia> CSV.read(io, DataFrame; header=false)
500×12 DataFrame
Row │ Column1 Column2 Column3 Column4 Column5 Column6 Column7 Column8 Column9 Column10 Column11 Column12
│ String15 String15 Float64 Int64 Int64 Int64 Int64 Int64 Int64 Int64 Float64 Int64
─────┼─────────────────────────────────────────────────────────────────────────────────────────────────────────────────────
1 │ mecA_BLAST CP026646.1 100.0 140 0 0 1 140 46719 46580 7.12e-65 259
2 │ mecA_BLAST CP154497.1 100.0 140 0 0 1 140 45702 45563 7.12e-65 259
3 │ mecA_BLAST CP049499.1 100.0 140 0 0 1 140 61014 60875 7.12e-65 259
4 │ mecA_BLAST CP030403.1 100.0 140 0 0 1 140 48633 48494 7.12e-65 259
5 │ mecA_BLAST CP132494.1 100.0 140 0 0 1 140 1867742 1867603 7.12e-65 259
6 │ mecA_BLAST MH798864.1 100.0 140 0 0 1 140 281 420 7.12e-65 259
7 │ mecA_BLAST CP162442.1 100.0 140 0 0 1 140 503005 503144 7.12e-65 259
8 │ mecA_BLAST OR082611.1 100.0 140 0 0 1 140 6415 6276 7.12e-65 259
9 │ mecA_BLAST CP053183.1 100.0 140 0 0 1 140 41607 41468 7.12e-65 259
10 │ mecA_BLAST CP085310.1 100.0 140 0 0 1 140 1610215 1610076 7.12e-65 259
11 │ mecA_BLAST CP162465.1 100.0 140 0 0 1 140 1140196 1140057 7.12e-65 259
12 │ mecA_BLAST CP133660.1 100.0 140 0 0 1 140 2821019 2821158 7.12e-65 259
13 │ mecA_BLAST CP049476.1 100.0 140 0 0 1 140 40314 40175 7.12e-65 259
⋮ │ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮ ⋮
489 │ mecA_BLAST CP093527.1 100.0 140 0 0 1 140 42814 42675 7.12e-65 259
490 │ mecA_BLAST CP035541.1 100.0 140 0 0 1 140 72431 72292 7.12e-65 259
491 │ mecA_BLAST CP145216.2 100.0 140 0 0 1 140 45830 45691 7.12e-65 259
492 │ mecA_BLAST CP193734.1 100.0 140 0 0 1 140 64595 64456 7.12e-65 259
493 │ mecA_BLAST CP083210.2 100.0 140 0 0 1 140 43331 43192 7.12e-65 259
494 │ mecA_BLAST MW052033.1 100.0 140 0 0 1 140 245 384 7.12e-65 259
495 │ mecA_BLAST CP168087.1 100.0 140 0 0 1 140 40806 40667 7.12e-65 259
496 │ mecA_BLAST CP150769.1 100.0 140 0 0 1 140 2583517 2583378 7.12e-65 259
497 │ mecA_BLAST CP030596.1 100.0 140 0 0 1 140 40848 40709 7.12e-65 259
498 │ mecA_BLAST MZ398128.1 100.0 140 0 0 1 140 16977 17116 7.12e-65 259
499 │ mecA_BLAST CP083199.2 100.0 140 0 0 1 140 40078 39939 7.12e-65 259
500 │ mecA_BLAST CP162663.1 100.0 140 0 0 1 140 938360 938499 7.12e-65 259
475 rows omitted
```
There are 500 hits with the same E-value and Bitscore.
This likely means that this sequence is an exact match to these 500 sequences in NCBI.
Because of this, the first row in the results is not necessarily a better match than the 500th,
even though it appears first.

To verify the first hit, we can look up the GenBankID of the first row: `CP026646.1`.
The NCBI [page](https://www.ncbi.nlm.nih.gov/nuccore/CP026646.1/) for this sample confirms that this sample was phenotyped as _S. aureus_.
Our query matches indices 46719 to 46580 on this reference genome.
When we use the Graphics feature to visualize gene annotations on the reference genome,
we see that there is a clear match to _mecA_ in the region that matches the query.

![BLAST Graphics](assets/mecA_BLAST.png)

Overall, this confirms that our BLAST worked as corrected!
3 changes: 3 additions & 0 deletions cookbook/assets/mecA_BLAST.fasta
Original file line number Diff line number Diff line change
@@ -0,0 +1,3 @@
>mecA_BLAST file that is used for BLAST tutorial
GAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAACATTGATCGCAACGTTCAATTTAATTTTGT
TAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTCCAGGAATGCAGAAAGACCAA
Binary file added cookbook/assets/mecA_BLAST.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading